Busch Lab

ZMP

ppp2r2bb

Ensembl ID:
ENSDARG00000079583
ZFIN ID:
ZDB-GENE-041010-39
Description:
protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform [Source:RefSeq pept
Human Orthologue:
PPP2R2B
Human Description:
protein phosphatase 2, regulatory subunit B, beta [Source:HGNC Symbol;Acc:9305]
Mouse Orthologue:
Ppp2r2b
Mouse Description:
protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform Gene [Source:MGI Sym

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29660
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113445 Nonsense 348 443 8 9
ENSDART00000134674 None None 45 None 2
ENSDART00000140118 None None 263 None 6
Genomic Location (Zv9):
Chromosome 21 (position 40255635)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 41763588
GRCz11 21 41776798
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTGTACGAGAATGACTGCATCTTCGACAAGTTTGAATGTGTCTGGAAT[G/T]GAACTGACAGGTACGTCAAAACCATGCGCGTCAAATCCTTCTCCTGGATG
Associated Phenotype:
Not determined