Busch Lab

ZMP

si:dkey-19j7.2

Ensembl ID:
ENSDARG00000079575
ZFIN ID:
ZDB-GENE-030219-193
Description:
Novel protein similar to vertebrate AF4/FMR2 family [Source:UniProtKB/TrEMBL;Acc:B0S769]
Human Orthologue:
AFF3
Human Description:
AF4/FMR2 family, member 3 [Source:HGNC Symbol;Acc:6473]
Mouse Orthologue:
Aff3
Mouse Description:
AF4/FMR2 family, member 3 Gene [Source:MGI Symbol;Acc:MGI:106927]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa45353 Nonsense Mutation detected in F1 DNA Not yet available
sa34619 Missense, Nonsense Mutation detected in F1 DNA Not yet available
sa34618 Nonsense Mutation detected in F1 DNA Not yet available
sa34617 Nonsense Mutation detected in F1 DNA Not yet available
sa13564 Nonsense Available for shipment Available now
sa9758 Nonsense Available for shipment Available now
sa21467 Essential Splice Site Available for shipment Available now
sa34615 Essential Splice Site Available for shipment Available now
sa21466 Essential Splice Site Available for shipment Available now
sa21465 Essential Splice Site Available for shipment Available now
sa21464 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45353
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Nonsense 81 1176 4 15
ENSDART00000131634 None None 180 None 2
ENSDART00000137922 Nonsense 98 1196 5 16
Genomic Location (Zv9):
Chromosome 9 (position 22533163)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21688949
GRCz11 9 21499818
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGAGACATTCTAGCTCGGGGTCTTCAGGAACAGACCGCTCCAGCGATT[G/A]GGAAAGCAGCAGTCAACGTTCCCGCAGCCCAAGTCCAGGGGCGCACACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34619
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Nonsense 140 1176 5 15
ENSDART00000131634 Missense 51 181 2 2
ENSDART00000137922 Nonsense 157 1196 6 16
Genomic Location (Zv9):
Chromosome 9 (position 22531312)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21687098
GRCz11 9 21497967
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGACAGATGGCTTGAGAAAGTACCTAAAAAGCATCAGTCCACTGACTA[C/A]AATCCAGGAGGAGGACACAGACAGAGTGCAAAATCTGACTGTGATCGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34618
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Nonsense 282 1176 5 15
ENSDART00000131634 None None 181 None 2
ENSDART00000137922 Nonsense 299 1196 6 16
Genomic Location (Zv9):
Chromosome 9 (position 22530888)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21686674
GRCz11 9 21497543
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAAGAAAGTCCCAGGCATATTTCACGGCCAACAGTTGCCTCCAATTCA[G/T]GACATCATCCCAAAGTCAGGCCATGGGTGCCTCCGGACCATAACGCTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34617
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Nonsense 309 1176 5 15
ENSDART00000131634 None None 181 None 2
ENSDART00000137922 Nonsense 326 1196 6 16
Genomic Location (Zv9):
Chromosome 9 (position 22530807)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21686593
GRCz11 9 21497462
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCGGACCATAACGCTAACCAGAGAAAAGAGTTAAGAGCCAAAGATTCT[C/T]GATCCAAAGACTCTCAGTCTAAAGACTCCAGACCTGGTCCTCAACATCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1920
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Nonsense 381 1176 5 15
ENSDART00000131634 None None 181 None 2
ENSDART00000137922 Nonsense 398 1196 6 16
Genomic Location (Zv9):
Chromosome 9 (position 22530591)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21686377
GRCz11 9 21497246
KASP Assay ID:
554-1909.1 (used for ordering genotyping assays)
KASP Sequence:
CTGTTTCAAAGCATCCGCTGCAGCAAAGACCCAGCATTAGCCCAAAACCT[C/T]AAGCCAGAACCTTATCTACAGTTGATCATAGTAGTGAATTTAATCACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13564
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Nonsense 786 1176 5 15
ENSDART00000131634 None None 181 None 2
ENSDART00000137922 Nonsense 803 1196 6 16
Genomic Location (Zv9):
Chromosome 9 (position 22529376)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21685162
GRCz11 9 21496031
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CRGGAAAGGCAAAAGAAAAGTCATCAATGAAGCATCTGAACCACTCTGAC[C/T]AACCACCTGGAGATGGCAGAAGTAAAAGAAARGTGAGGGGGGNAAAGAMAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9758
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Nonsense 815 1176 6 15
ENSDART00000131634 None None 181 None 2
ENSDART00000137922 Nonsense 832 1196 7 16
Genomic Location (Zv9):
Chromosome 9 (position 22529176)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21684962
GRCz11 9 21495831
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAATGGAGACCTTCMAAGAGAGAATAAGAGAAATCACTCGTGTACAGAT[A/T]AACAACCATCATCAGTCCATCATGAGACAGAGGAAACCTGTGTGGACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21467
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Essential Splice Site 835 1176 7 15
ENSDART00000131634 None None 181 None 2
ENSDART00000137922 Essential Splice Site 852 1196 8 16
Genomic Location (Zv9):
Chromosome 9 (position 22528763)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21684549
GRCz11 9 21495418
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATGGCTCATGCTCTTTGGGTGACATCTCTTCTTAAATGCCGTTTATGC[A/C]GATGTCAGGATGATTACTTTTACTCCAAGAGGCCAGTGTCCCCATTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34615
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Essential Splice Site 933 1176 8 15
ENSDART00000131634 None None 181 None 2
ENSDART00000137922 Essential Splice Site 950 1196 9 16
Genomic Location (Zv9):
Chromosome 9 (position 22528198)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21683984
GRCz11 9 21494853
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCCAAACCTTCCTCTTCACTACAGAGGAACAGTACCTATTAGTGATGT[G/A]TAAGTTAATGTCTTCTTCAGTGAACAACACTAGAGCATAGTTTGGCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21466
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Essential Splice Site 1055 1176 12 15
ENSDART00000131634 None None 181 None 2
ENSDART00000137922 Essential Splice Site 1075 1196 13 16
Genomic Location (Zv9):
Chromosome 9 (position 22525575)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21681361
GRCz11 9 21492230
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAAGACCATGCCCTGAAATACTCTAAAGTCCTGCTAGACTACTTCAAG[G/T]TAGGCATTATTCAAGAGAAATGCCTACTAATGCTAAGTACAAACTGTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21465
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Essential Splice Site 1055 1176 12 15
ENSDART00000131634 None None 181 None 2
ENSDART00000137922 Essential Splice Site 1075 1196 13 16
Genomic Location (Zv9):
Chromosome 9 (position 22525574)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21681360
GRCz11 9 21492229
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAGACCATGCCCTGAAATACTCTAAAGTCCTGCTAGACTACTTCAAGG[T/C]AGGCATTATTCAAGAGAAATGCCTACTAATGCTAAGTACAAACTGTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21464
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108750 Nonsense 1059 1176 13 15
ENSDART00000131634 None None 181 None 2
ENSDART00000137922 Nonsense 1079 1196 14 16
Genomic Location (Zv9):
Chromosome 9 (position 22525460)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21681246
GRCz11 9 21492115
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGACTTACCCATACATGTTTTATTACCTTTTTTAAATCAGAGTTCTCCA[A/T]AAGGACCTCACAACCCCCCTACAAGGAACGATTCTGGAAAGTAAGATACA
Associated Phenotype:
Not determined