Busch Lab

ZMP

si:dkeyp-94b4.3

Ensembl ID:
ENSDARG00000079572
ZFIN IDs:
ZDB-GENE-081031-64, ZDB-GENE-081222-2, ZDB-GENE-081222-2, ZDB-GENE-081222-2
Description:
Novel protein similar to H.sapiens phospholipase C, delta [Source:UniProtKB/TrEMBL;Acc:B8JIR0]
Human Orthologue:
PLCD3
Human Description:
phospholipase C, delta 3 [Source:HGNC Symbol;Acc:9061]
Mouse Orthologue:
Plcd3
Mouse Description:
phospholipase C, delta 3 Gene [Source:MGI Symbol;Acc:MGI:107451]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31867 Essential Splice Site Available for shipment Available now
sa22061 Essential Splice Site Available for shipment Available now
sa24906 Nonsense Mutation detected in F1 DNA Not yet available
sa22062 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31867
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079784 Essential Splice Site 275 769 5 15
ENSDART00000135143 Essential Splice Site 120 244 2 5
ENSDART00000145612 None None 287 None 6
ENSDART00000079784 Essential Splice Site 275 769 5 15
ENSDART00000135143 Essential Splice Site 120 244 2 5
ENSDART00000145612 None None 287 None 6
Genomic Location (Zv9):
Chromosome 12 (position 16483774)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15594739
GRCz11 12 15637046
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGTACATGCGCAGAGCCTCATCCTCACCTATGAGCTCAATGAATGGGG[T/A]ATCTTCTATTCACTTTTTGTGTTTTTTTGTATACACAATTCTTGGTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22061
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079784 Essential Splice Site 275 769 5 15
ENSDART00000135143 Essential Splice Site 120 244 2 5
ENSDART00000145612 None None 287 None 6
ENSDART00000079784 Essential Splice Site 275 769 5 15
ENSDART00000135143 Essential Splice Site 120 244 2 5
ENSDART00000145612 None None 287 None 6
Genomic Location (Zv9):
Chromosome 12 (position 16483774)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15594739
GRCz11 12 15637046
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGTACATGCGCAGAGCCTCATCCTCACCTATGAGCTCAATGAATGGGG[T/A]ATCTTCTATTCACTTTTTGTGTTTTTTTGTATACACAATTCTTGGTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24906
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079784 Nonsense 486 769 10 15
ENSDART00000135143 None None 244 None 5
ENSDART00000145612 Nonsense 4 287 1 6
Genomic Location (Zv9):
Chromosome 12 (position 16505110)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15616075
GRCz11 12 15658382
KASP Assay ID:
554-7288.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTTTTTTTTTTTTTTTTCCTTTTACATTTCCTCAGAGAGACTGTAAGT[T/A]GAGTTCTGAACTGTCTGATCTGGTGGTTTATACCTCCAGTGTTGCCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22062
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079784 Nonsense 586 769 12 15
ENSDART00000135143 None None 244 None 5
ENSDART00000145612 Nonsense 104 287 3 6
Genomic Location (Zv9):
Chromosome 12 (position 16505854)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15616819
GRCz11 12 15659126
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCAGTGGCACTGAACTTCCAAACCCAATCTGAAGAGATGGATCTGAAC[A/T]GAGGCCGTTTCTTAGCAAACGGAAATTGCGGCTATGTGCTAAAACCAAGC
Associated Phenotype:
Not determined