Busch Lab

ZMP

si:dkey-265k11.4

Ensembl ID:
ENSDARG00000079552
ZFIN ID:
ZDB-GENE-090313-292
Description:
Novel protein similar to H.sapiens MAML3, mastermind-like 3 (Drosophila) (MAML3) [Source:UniProtKB/T
Human Orthologue:
MAML3
Human Description:
mastermind-like 3 (Drosophila) [Source:HGNC Symbol;Acc:16272]
Mouse Orthologue:
Maml3
Mouse Description:
mastermind like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2389461]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa19539 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19539
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114659 Nonsense 857 1099 5 5
ENSDART00000144135 Nonsense 180 387 3 3
Genomic Location (Zv9):
Chromosome 1 (position 40729816)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39619225
GRCz11 1 40337298
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCAAACATGGGTCAGATGCTCCAGCAGCAACAGCAGCACCATCCCAAC[C/T]AGGCAAGCATGGCGATGGCACAGAGGCAAGCGGGTGCCGGTGGACAGGGG
Associated Phenotype:
Not determined