Busch Lab

ZMP

si:dkey-31k9.2

Ensembl ID:
ENSDARG00000079528
ZFIN ID:
ZDB-GENE-070912-512
Description:
Novel protein similar to vertebrate human immunodeficiency virus type I enhancer binding protein 1 (
Human Orthologue:
HIVEP1
Human Description:
human immunodeficiency virus type I enhancer binding protein 1 [Source:HGNC Symbol;Acc:4920]
Mouse Orthologue:
Hivep1
Mouse Description:
human immunodeficiency virus type I enhancer binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:96100

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa18568 Nonsense Available for shipment Available now
sa13312 Nonsense Available for shipment Available now
sa17128 Nonsense Available for shipment Available now
sa43204 Splice Site Mutation detected in F1 DNA Not yet available
sa9898 Nonsense Available for shipment Available now
sa18511 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18568
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110201 Nonsense 655 2621 2 7

The following transcripts of ENSDARG00000079528 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3956962)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3453535
GRCz11 19 3394433
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTGCCCARTTGTGGCAGCTGTCAKGCATGTAGCAACTATTGAAAAGCCT[C/T]GAGTTCCTTCAGGACAAATGCGTCCTCCATTGGAAACCAAAGCTCWATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13312
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110201 Nonsense 1511 2621 2 7

The following transcripts of ENSDARG00000079528 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3954394)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3450967
GRCz11 19 3391865
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATAACAATACCAATAGCTAATGAAATTAAAGGGTCACATTCAAATGAT[G/T]GAATGCAAAATGTCTATGTTGCACAATCAAGTTATCAGGCTGTACTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17128
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110201 Nonsense 1788 2621 2 7

The following transcripts of ENSDARG00000079528 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3953561)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3450134
GRCz11 19 3391032
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAGAGAATTCCACTTTAAAGCCACAAGAGAAACCTGAGGAGCAGCGCTG[G/A]TCTCCATCAAAATCACCTCTGAGGCCTCCATCATTTCAGGGACAAGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43204
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110201 Splice Site None 2621 None 7

The following transcripts of ENSDARG00000079528 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3953070)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3449643
GRCz11 19 3390541
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACGCTAGGATAAATAAACGATTAACAAATTCTTCTCACTTCTTTTATC[G/A]CTTCAGGTTTTGATACAGCAAAGATCTGTGCCAAGTGAGAATAGTGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9898
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110201 Nonsense 2087 2621 6 7

The following transcripts of ENSDARG00000079528 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3951190)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3447763
GRCz11 19 3388661
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGACTCTGATGGCCCAGATGATGAAGATAATGAGGGAGAGGAGGAAGAT[G/T]AGGAGGACAGCCAGGCAGAGTCTGGCCTTTCTGCTACACCTTCYGTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18511
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110201 Nonsense 2395 2621 7 7

The following transcripts of ENSDARG00000079528 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3950001)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3446574
GRCz11 19 3387472
KASP Assay ID:
2261-2806.1 (used for ordering genotyping assays)
KASP Sequence:
CTTGTTTCCCCCTTGGYCAAGTGGCAGGGCTTCARACACTTGGTGCTCAC[C/T]AGACCRCCCTGCAGCCTGTGGGTTTGGAGAYCTTGAGTGTTGTAGGTTTA
Associated Phenotype:
Not determined