Busch Lab

ZMP

si:ch211-69e5.1

Ensembl ID:
ENSDARG00000079519
ZFIN ID:
ZDB-GENE-090313-130
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JI71]
Human Orthologues:
CRB1, CRB2, DNER, JAG1, JAG2
Human Descriptions:
crumbs homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:2343]
crumbs homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:18688]
delta/notch-like EGF repeat containing [Source:HGNC Symbol;Acc:24456]
jagged 1 [Source:HGNC Symbol;Acc:6188]
jagged 2 [Source:HGNC Symbol;Acc:6189]
Mouse Orthologues:
Crb1, Crb2, Dner, Jag1, Jag2
Mouse Descriptions:
crumbs homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2136343]
crumbs homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2679260]
delta/notch-like EGF-related receptor Gene [Source:MGI Symbol;Acc:MGI:2152889]
jagged 1 Gene [Source:MGI Symbol;Acc:MGI:1095416]
jagged 2 Gene [Source:MGI Symbol;Acc:MGI:1098270]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa42268 Nonsense Mutation detected in F1 DNA Not yet available
sa17288 Essential Splice Site Available for shipment Available now
sa35566 Nonsense Mutation detected in F1 DNA Not yet available
sa22361 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42268
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108504 None None 573 None 12
ENSDART00000140645 Nonsense 44 217 2 5
Genomic Location (Zv9):
Chromosome 13 (position 38436576)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37913388
GRCz11 13 38039278
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTGTTCAGAACACGCCGTCTGTGTGGACCAACAGCACAACTACACCTG[T/A]CGCTGCATGCTGGGATATGAGGGAACGCTCTGTGAGCTTGAGACAGATGA
Long Flanking Sequence:
TTGGGGAAAAAAAAAAAAGTGTTTAAAATAAACCATTACAATGCAGGAATTAAAAACACATTAGTGAATAAATTTAGGAAATAAATAAATCTATAATAGCATTTTGTTTTCCCATTGTAGTATTTATTTTTTTTTTGGATTTATATTTAACAGGGTGCTTCTCTCTGTATGAAATTAAAATTGAGATTCAGATCAGGTTCAATGGCTGTTAACGGTCTCATTCTAGAATTAAACCACCCATAGCTGCTGAAACAAATAGCATGTTCCTGTGATGGAAAGCAAAGCAAATTACATCGTCCTCCCCCATGACTCAGCCATTTATTTTCATACTGTGTCCGGCTGTTTTGTTTTGCGATTCCATTAAGAGATACTGTTTTATGCATCCCAAGTTGCCTTTGCGGTCACGGATACACCGGAGTCCACTGCGAACTTGACTTCTGCTCTGGACATCAGTGTTCAGAACACGCCGTCTGTGTGGACCAACAGCACAACTACACCTG[T/A]CGCTGCATGCTGGGATATGAGGGAACGCTCTGTGAGCTTGAGACAGATGAATGCAAAAGTGCGCCGTGCACCAATAATGCCACTTGCATTGATTTGGTGGCAGGATACCAATGCCTGTGTGCACCAGGATTTAAGGGTAAGTCAAATGTTTTATTTAGAAGTGTTAACGTGGGCGGGGAAACTCCAGCCCTTTGATAGACATTGACTTTCAGTAGCTCATTTTGACATCATTGATTTCCTCGAGATTTAAAGAGGGCACTGGGGTTTTAAATGATTGTTATAATGTTTTTTTTTTAAATCTATAATTAATTTGAATTAAATAATTAATGTACAATTGACCTTCTCAATTGATTCTTATATGCAGTGGCCACATTTTGTGAATATCATATTTTCCGGAAAAAATATTTGCAACTTGCATGTAAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17288
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108504 Essential Splice Site 44 573 None 12
ENSDART00000140645 Essential Splice Site 90 217 None 5
Genomic Location (Zv9):
Chromosome 13 (position 38436438)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37913250
GRCz11 13 38039140
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGATTTGGTGGCAGGATACCAATGCCTGTGTGCACCAGGATTTAAGGG[T/G]AAGTCAAATGTTTTATTTAGAAGWGTTAACGTGGGCGGGGAAACTCCAGC
Long Flanking Sequence:
ATTTATATTTAACAGGGTGCTTCTCTCTGTATGAAATTAAAATTGAGATTCAGATCAGGTTCAATGGCTGTTAACGGTCTCATTCTAGAATTAAACCACCCATAGCTGCTGAAACAAATAGCATGTTCCTGTGATGGAAAGCAAAGCAAATTACATCGTCCTCCCCCATGACTCAGCCATTTATTTTCATACTGTGTCCGGCTGTTTTGTTTTGCGATTCCATTAAGAGATACTGTTTTATGCATCCCAAGTTGCCTTTGCGGTCACGGATACACCGGAGTCCACTGCGAACTTGACTTCTGCTCTGGACATCAGTGTTCAGAACACGCCGTCTGTGTGGACCAACAGCACAACTACACCTGTCGCTGCATGCTGGGATATGAGGGAACGCTCTGTGAGCTTGAGACAGATGAATGCAAAAGTGCGCCGTGCACCAATAATGCCACTTGCATTGATTTGGTGGCAGGATACCAATGCCTGTGTGCACCAGGATTTAAGGG[T/G]AAGTCAAATGTTTTATTTAGAAGTGTTAACGTGGGCGGGGAAACTCCAGCCCTTTGATAGACATTGACTTTCAGTAGCTCATTTTGACATCATTGATTTCCTCGAGATTTAAAGAGGGCACTGGGGTTTTAAATGATTGTTATAATGTTTTTTTTTTAAATCTATAATTAATTTGAATTAAATAATTAATGTACAATTGACCTTCTCAATTGATTCTTATATGCAGTGGCCACATTTTGTGAATATCATATTTTCCGGAAAAAATATTTGCAACTTGCATGTAAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGATAGATAGATAGATAGATAGATAGATGGATTTACAAAAAACTAAAACCTAATAATGATGAAAAACACACAAACTAGTTACTAAGACTTTGTTCAAATGTTTTATTGAGAAAAAACACACTATTACAAAAATTGTTACCATTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28177
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108504 Nonsense 120 573 3 12
ENSDART00000140645 Nonsense 166 217 4 5
Genomic Location (Zv9):
Chromosome 13 (position 38389699)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37866511
GRCz11 13 37992401
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTGCGAAGAGCAGCAGGATGGTTTTAAGTGCGTATGTCACCATGGCTA[T/A]ACGGGCCTGTTTTGTGAAACGTCCATCAATCACTGCGTCGAGGGATTGTG
Long Flanking Sequence:
ACCATATGGTTAGTTTTGATTTTTTGGGGACTTTGATGTGAACTAGTGTGTTTTTTGTATACTTTTTAAAGAGCTCATTCCAACACATATAACAGCATGTTTTTGCCTCCTTCCAAACAAAATGTGTAATTTACTTTTGAGGTATTTTAAGCTCAAACTTCAGACACATTCTGTGGACACCAGAGACTGATATCATCTTATAAAGAAGCACAAACAACTAATTTAATTGATTGGCATCATATTTCTCATTTGCTCCAATTATTATGGATACAAAGTACCAGATTTGGAAACAGTGAGGCATGATGACTGAACAGCAAACGTCAAAATATATGAGCCATATCTCCATCAGTGAGCTCTTTCATCTTAATTCACACAGGATTCACAGGACATGACTGCTCCATGCCGGCTACGGGCTGCACTTCCAACCCGTGCAACACAAAGGGCACTTCCATGTGCGAAGAGCAGCAGGATGGTTTTAAGTGCGTATGTCACCATGGCTA[T/A]ACGGGCCTGTTTTGTGAAACGTCCATCAATCACTGCGTCGAGGGATTGTGTCATCACGGATCAGAATGCGTGGATCTCACTAAAGGCTTCATGTGTGAATGTTTGCCTGGTAAGAGTGATTTCTCTACAGTTTGTCTTACTGCCCCGTCCCTCAATCCACACCATTTAACCCTCAACCCATTTTCATCTGTGCTCAGGGTTACGAGGACGATTGTGCGAGGTAAACATTGATGACTGTCTGGATAAGCCCTGTGGTGCACTCAGTATCTGTAAAGATGGTATCAATGCCTATGACTGTTTTTGTGCACCTGGGTTCGTCGGTAAGTCCACCACAAGCAATTTTCTAGAGCAATTTTTCCTTTGCCCAGTTTTCTAACATTCAATTCCCCTGTGTTGAGCCGTGTTTAAAAGGTCTGCGCCCTCAAATCTGCCCCTGTATTGTAAGACATTAGTTGACCGTCTGCTTATCAAGGGGAATTTCCTAAACTGCATTACCCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35566
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108504 Nonsense 230 573 5 12
ENSDART00000140645 None None 217 None 5
Genomic Location (Zv9):
Chromosome 13 (position 38388931)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37865743
GRCz11 13 37991633
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAATGGAGCGTCCTGCTCAGATGAGCTTAACTCCTTCAGCTGTCTCTG[C/A]CTTGCCGGCACTACAGGTACACAATTCCTTCCTGCAGAGTTTCAAGGGCT
Long Flanking Sequence:
CTGTAAAGATGGTATCAATGCCTATGACTGTTTTTGTGCACCTGGGTTCGTCGGTAAGTCCACCACAAGCAATTTTCTAGAGCAATTTTTCCTTTGCCCAGTTTTCTAACATTCAATTCCCCTGTGTTGAGCCGTGTTTAAAAGGTCTGCGCCCTCAAATCTGCCCCTGTATTGTAAGACATTAGTTGACCGTCTGCTTATCAAGGGGAATTTCCTAAACTGCATTACCCTGCCATCACATTTTCTGGCATCCATTTGACCAAGGAGACAGGAGAAGGATTTTTTTTCTGTCTCGCGCAGCACCTCATCATTAGCTGTAGGTTATTTTATTTGAAGGGGTATCACGGCCCCTTTATTTGCAAGGAAATCTTTAATGAAATGAACCTTTCCCCTTCTTTTCAAGGTAATAACTGTGAGATTGAAGTAAATGAGTGTCTTAGTCAACCCTGTCAGAATGGAGCGTCCTGCTCAGATGAGCTTAACTCCTTCAGCTGTCTCTG[C/A]CTTGCCGGCACTACAGGTACACAATTCCTTCCTGCAGAGTTTCAAGGGCTCAGCTTGTGTGATTGAGGCCACATAGATACATTTGGAAATTGACAACAGTTTGAATGTTGATTTTTTTTTTTTTTCCTTTAATTTACTTATTTGTTTGGTTAACATGTTAGCACTACAAGTACAGTAATTATAAAATCAGTCCAAATATAAATACATAAAGAAAACATCATATTAATTGGAACTTAAAGATAGAGACTTAAACTTACATCTTAGCAATGCGTTTTTTACAACTCTGGGGTGCCAAAAAGAAATTCTAAACGTACGAATTTACAACTATATATAATTATAAACATTATCATCTTTAATTGAAAATTGCTGACAATGCCATTTATGCATGCACGAATTCTGTTTTTTTATATGTGTACAGAACACTTTATTACCAAATCTATTGCAGATAAAAGTAATATAATAAAATAATATTTAACAACTATAAACCAACATACAGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22361
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108504 Nonsense 429 573 10 12
ENSDART00000140645 None None 217 None 5
Genomic Location (Zv9):
Chromosome 13 (position 38349432)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37826244
GRCz11 13 37952134
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCTTCATTTGCATTTCAGAGTTACAACTGCCTCTGTCTACCCGGATGG[G/T]AGGGGGAGTACTGTCAAAGGGAGACCAATGAATGTTTATCAAACCCCTGT
Long Flanking Sequence:
TTACTTTGTATATAGTCACACTTAAATGTTTGACATTTTGCTACCTTTGCTTATTATGTGTGCCTTTTTAGCCTCCAAGTGTCCTTAAAAAAAAAAAAAAAACTTTCACCTTGGGAAAAAATCTTGCACAAAATACTGTTTATTAATGTTTACACATCAATCTGATAGATCACGTTGTTTATAGTCGCAAGTATTTAAGCCATTTTGACCTTTAATACAAGCTGTTCTGTGAATTCTGTACAATTTTGGTCTATATTGCTTTCACACGGCAGCGCTTTGCTATGTCATCATCTGTTATTCTGTTCATTTACTGTACAGTGAATATAATGCTTTAATGAAGACATTTTCATGTGCGCCGAGTGATCTGTGGAATAATACGTCGTATTCATCTAGGTCAAGGTAAGTGTTAGATGAAAGAGTTACATCGCTGTCTAATATCTTTTCATTTGCTGTCTTCATTTGCATTTCAGAGTTACAACTGCCTCTGTCTACCCGGATGG[G/T]AGGGGGAGTACTGTCAAAGGGAGACCAATGAATGTTTATCAAACCCCTGTAAAAATAACGCCACCTGCACAGACCTCCTCAATGCTTACAGGTGGGTTGCATAAATGCAGCTTGGTCGGAAAAGGAAATCTGTATGAATGGACGGGCTAGAGATAAATCATGGTGACTAGTTGTCTTATCTAGCTGGCAGTAGTTCAGATTATATAGGTTTTTTATTAATTTAAAGGCTACCAATTTTGTAAAAGTCACTCTTATATGGTATTTGAATAAAGATACAGTTAAATTAAAATTATTAGACCTCATGTGGTTTTCAGATATTTCCCAAATGGTGTTTAACAGAGCAAGTACATTTACACAATATTTCTTATGATATTTTTTTCTTCTGGCGAAAGTCTTATTTGTTTTATTTCTGCTGGAAATAAAATCTGTTTTTTTTTTTTTTTTAATCATGTTGAGGTCAAAATTATTTATTGTCAAAATTGGTTATTATCAATTCAATT
Associated Phenotype:
Not determined