Busch Lab

ZMP

si:dkey-23h1.5

Ensembl ID:
ENSDARG00000079515
ZFIN ID:
ZDB-GENE-081104-385
Description:
Novel protein similar to vertebrate pentraxin-related [Source:UniProtKB/TrEMBL;Acc:B8JJS8]
Human Orthologue:
PTX3
Human Description:
pentraxin 3, long [Source:HGNC Symbol;Acc:9692]
Mouse Orthologue:
Ptx3
Mouse Description:
pentraxin related gene Gene [Source:MGI Symbol;Acc:MGI:104641]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10533 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3389
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112933 Nonsense 226 440 2 3
ENSDART00000131978 Nonsense 173 387 1 2
Genomic Location (Zv9):
Chromosome 2 (position 36413119)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36709829
GRCz11 2 36692286
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGCCACTGCTGATCTYCAAAGGGTGCATGCCCAACTGGCCCTTTTCCAG[A/T]GAGCAACMGTAMACCGCTATCTGCCCTCAGGTACATGATTCAGCTGTAAT
Long Flanking Sequence:
TCCCCTGTCCACCCCAGGACCTCTCCCGCTGGGACAAACTCTTCATTATGCTGGAAGACTCTCAGATGAAGCAAAACATGCTCCATTGGCAGACTGAAGACATGGTCAAGAAAGAGATGGACTCTATACGGAAGGATCTCCATAAGCTTAACAATAACAAAGCATGTGTCCAGGCTTCAGAAAACACTTGCAAGTGCATAAGCGAACAGATGAACCGCAATATAAAGCAAGTTATGGAGCAGCTCAGAGAGGCTGCAGATTCTCATCAAGCCCAAAACAATGAGACGCTGCAGCAGCTCATTCAGCTGAGCCGACATCAGGCTTCCCGTCTCGCCAAACTGGAGTTAGGAGCAGGACTAGGGCAGGTGGCCGTGAAGTCTTTTTCTGTTTATCCAAAAGAACAAGAAGCAAGCAGTGCAGATGGTGGGAAGTTGGAGAGAGCACTAATGGCCGCCACTGCTGATCTCCAAAGGGTGCATGCCCAACTGGCCCTTTTCCAG[A/T]GAGCAACCGTAAACCGCTATCTGCCCTCAGGTACATGATTCAGCTGTAATATGTAATGATATTAACTACAGAATCATTGATGATTTCCCACTTTAAAAAATAAAAATAAAATAAAATATATAAAGGCGATGCAGTGGCGCATTAGGTAGTGCTGTCGCCTCACATTAAGAAGGTCGCTGGTTTAAACCTCGGCTCAGTTGGCATTTCTGTGTGGAGTTTTCATGTTCTCCCTGCATTCGCGTGGGTTTCCTCCGGGTGCTCCGGTTTCCCCACAGTCCAAAGACATGCGGTACAGGTGAATTGGGTAGGTTAAATTGTCCGTTGTGTATGAGTGTGTGTGTGTGTGTGTGTATGTATGGATGTTTCCCAGAGATGGGTTGCGGATGGAAGGGCATCCGCTGCGTAAAAACATGCTGGATAAGTTGGCGGTTCATTCCGCTGTGGCGAATTAATAAAAGGGACTAAGCCGACAAGAAAATGAATGAATAAATAAAATACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10533
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112933 Nonsense 285 440 3 3
ENSDART00000131978 Nonsense 232 387 2 2
Genomic Location (Zv9):
Chromosome 2 (position 36415509)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36712219
GRCz11 2 36694676
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTRTGGGCCAAAGTGACTCAGGCTCTTAATAAAACAGTTCTTTTCTCWTA[C/A]GGAAGCAAGATAAAYCCTCAAGAGCTCCAGCTTCTTCTGTCAGGTYGCTC
Long Flanking Sequence:
TGGCAAATGTTTAAAAAAAATAAATAAATAAAGGGGGCTAATAATTCTGACTTCAAGTATGTATATGTGCCATCTGAAATTTTCTTTTAATATTGCAATTTTTCTCAGGCTCCTATGTCTTGATTCAGTAATTTCCCTTTTATGAAAAAAAAAAAGTTCTTTTTCTTGCTTTTAACATGAAATAACTGAACATGAACATAAGAGGTTGAGAAAAATGCTCATTGTAGAAGAAAATTGCAGATGGCACTTAGAGGTTTTTGCATCTGAACTCTTTATATATATTTACTGTGTGATGATTCAGTGCCATAATTATTCTTTCATTCCTTATTTCTTCCTTTTCTCATTTTTCAAGGGTGTGAGATGGCTTTGTTATTTCCAATGCGCTCCAAGCACATCTTCGCAGAAGTAACACCCTCCATGTCCATGTCTCTACAAACATTCACTCTCTGTCTGTGGGCCAAAGTGACTCAGGCTCTTAATAAAACAGTTCTTTTCTCATA[C/A]GGAAGCAAGATAAACCCTCAAGAGCTCCAGCTTCTTCTGTCAGGTCGCTCACTACTCCTCAAGGTGGGCGGTGACACTGGTCTAGTGGAAGCTCTTGGTGTAGTAACAGATGGGCAGTGGGGACACTTTTGCGCCACTTGGAGCTCAAAGCAGGGTTTGGCTGATTTGTGGGTGAATGGAGAAAGTGTTGCCAGAGTGTCTGGAGTAGCAGAAGGCCACGAACTGCCCAGTGATGGGTTCATTTTGCTTGGACAGGAGATCAGCCGGTCGGGAATTTACAGAGATCTGGTCTCAACTGTAGTCTTCACCGGGAAGATGACAGGGGTGAACATGTGGGACCACGTGCTGGAGGCGGAGAGGATTAAAGAGTACGCCAATCAGGACGGGTCATGTGATAGCAGAGGGAATGTGATTGGATGGGGCATTTCAGAGATCGTTCCAAATGGTGGAGCTCAATATATCAACTGAGACTGCACCAATATCTACTGGCTAAAGCTGTG
Associated Phenotype:
Not determined