Busch Lab

ZMP

si:dkey-13f9.5

Ensembl ID:
ENSDARG00000079508
ZFIN ID:
ZDB-GENE-030131-6308
Human Orthologue:
FAM114A2
Human Description:
family with sequence similarity 114, member A2 [Source:HGNC Symbol;Acc:1333]
Mouse Orthologue:
Fam114a2
Mouse Description:
family with sequence similarity 114, member A2 Gene [Source:MGI Symbol;Acc:MGI:1917629]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa37359 Nonsense Available for shipment Available now
sa24007 Nonsense Available for shipment Available now
sa39342 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12732 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37359
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110220 Nonsense 193 520 5 13
ENSDART00000133585 Nonsense 193 572 6 14
Genomic Location (Zv9):
Chromosome 21 (position 36756226)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37745575
GRCz11 21 37430762
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGTTTGATGACTAGAGTAAAACAGTAATAAGCGGTGGCCTTGATGCAT[T/A]GGAGTTTATCGGGAAGAAAACCATGGATGTGATTGCAGAGGGAGACCCCG
Long Flanking Sequence:
GCTAAGCAGTTAATTAATTATTTTGGTTATATTTTATTTTAAAGTACAATTCTTGCTATTATTAAACCATTAACTTTGGCTTTTGCCTCATTAAACTCCTAATTTGCTGTTTATCAATAGTTATTAAGATAATAGTTGGATTTAGTTACTGGCTTAGGGATGCAGAATATGTACTTTATGTACTAAAAGGCCAATATCATCATCATAATAATAGGCATGCCAATAAGGAACTAGTTACACTGAAGTGTTATCATTATTTATGTATTTATTATTTAATAATTTTAAAATAATTTTTCCACGGCTTGGTATGCTGGTTGAACATTTCTGAATTTTCATTGCCAATTTTAGCCAATGGTTATTCAGTTAAAAGCCAATGGTCGTAATAGTTTGTTTTGGGCCAATTTCCACATTTTCTTTGTTTTATTGTATGTATGTTTTTACACTTCTTCTCATGTTTGATGACTAGAGTAAAACAGTAATAAGCGGTGGCCTTGATGCAT[T/A]GGAGTTTATCGGGAAGAAAACCATGGATGTGATTGCAGAGGGAGACCCCGGCTTTAAGAAAACCAAAGGACTGATGAACAGAAACTCCACACTATCACAGGTACAGGAGAGAATAAGATTAAAGAATATATTCATAGCAACTTCAGCTGCCCTCCTGACACAAATATATTACTCAATCCTATCTGATTTTGTTTGCATTAAACTGATCTGATTTTTGTTTCCTTAAAGGTCTTGAGAGAAGCCAAAGAATGCGAGGAGCAGCAAAAAGCTGAAAATGCCACTTCAGAACCAAACAAAAAGGCTCATTATGGGATGCTGTTCGACGAGTTTCAAGGCTTGTCTCATTTGGAGGCTTTGGAGATCCTGTCTAGAGAGAGCGAAGCCAAGGTCAGTTCTTGACTGATTTAACACACTGAGATAGAATATGAAATGGTGAAAGATTTAAACATGTTGTGATTTGGTGCAGGTGAAATCTGTTCTGACAACGCTGTCTGGCGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24007
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110220 Nonsense 249 520 6 13
ENSDART00000133585 Nonsense 249 572 7 14
Genomic Location (Zv9):
Chromosome 21 (position 36755931)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37745280
GRCz11 21 37430467
KASP Assay ID:
2261-5936.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAATGCGAGGAGCAGCAAAAAGCTGAAAATGCCACTTCAGAACCAAAC[A/T]AAAAGGCTCATTATGGGATGCTGTTCGACGAGTTTCAAGGCTTGTCTCAT
Long Flanking Sequence:
CCACGGCTTGGTATGCTGGTTGAACATTTCTGAATTTTCATTGCCAATTTTAGCCAATGGTTATTCAGTTAAAAGCCAATGGTCGTAATAGTTTGTTTTGGGCCAATTTCCACATTTTCTTTGTTTTATTGTATGTATGTTTTTACACTTCTTCTCATGTTTGATGACTAGAGTAAAACAGTAATAAGCGGTGGCCTTGATGCATTGGAGTTTATCGGGAAGAAAACCATGGATGTGATTGCAGAGGGAGACCCCGGCTTTAAGAAAACCAAAGGACTGATGAACAGAAACTCCACACTATCACAGGTACAGGAGAGAATAAGATTAAAGAATATATTCATAGCAACTTCAGCTGCCCTCCTGACACAAATATATTACTCAATCCTATCTGATTTTGTTTGCATTAAACTGATCTGATTTTTGTTTCCTTAAAGGTCTTGAGAGAAGCCAAAGAATGCGAGGAGCAGCAAAAAGCTGAAAATGCCACTTCAGAACCAAAC[A/T]AAAAGGCTCATTATGGGATGCTGTTCGACGAGTTTCAAGGCTTGTCTCATTTGGAGGCTTTGGAGATCCTGTCTAGAGAGAGCGAAGCCAAGGTCAGTTCTTGACTGATTTAACACACTGAGATAGAATATGAAATGGTGAAAGATTTAAACATGTTGTGATTTGGTGCAGGTGAAATCTGTTCTGACAACGCTGTCTGGCGAGGAGCTGACAAAACTTAGAGAAGATCTGCAGAATATTAAAGAGCCTTTTTCACTCATGGAGTTTGACGATGAGCTGGAGGATGATACGAAATGTAAGAAACTACAATTAATACAAGGCTAAAATTTACAAAATTAAACATTAAATTCTTAGTTCAAGCACAAATTAAGATATTTTAAATCAAATCTTAGAAATGCATGTCCCTTAATTGAAAGTCTATTCTCCTAAAACTCTTCAAAATGTTTATAAAGAGATTTTTAAAACTCCATATGGATTGAGCAGTTTAATCTAAGCCTGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29644
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110220 Nonsense 339 520 8 13
ENSDART00000133585 Nonsense 339 572 9 14
Genomic Location (Zv9):
Chromosome 21 (position 36751635)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37740984
GRCz11 21 37426171
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGATGGAGAGGACTTTGTGAAGGAACTAACAGATGTTCTTAAAGGACTA[C/T]AGATTTCCACATCAGCAGACAAACTCAGCAAGGTTTCACTTGAAGATTAG
Long Flanking Sequence:
AATAGAAACTATTACAGTTTTTGAAATACAGACAAATATATTCAATATATTTTATCGGATTGTATTGTATTGTATTTTATTGTGACAAGATGTTCAGTTTACACCCCTACTCAGTTTTAGTCATAGAACTCATACATGCTTTCTCAATGTGTGAGTACCAACGAGGTTTATTCTTGCATCACATGACAGATGTTTGAGCTTCTGCAAGGACCAATAAGCTTTGCTGATGTGTGTCAATATGTAAATAAAACATCCAATGAAACACATTCCTTATGTAGAGAAACAATTTGAATCTAATCAGTTTGGAAGCATGAGAGTTTCAGAGTGAAAAGACTTTAAAAGGACGGACCGAAATTTCTCCCATTTTATTAAAAATATCTTCCATGTGCTCCAAATGATGAACAAAAGTCACAGGTTTGCTCATATTATTATTTTTTTAATCCTCAGGTGATGATGGAGAGGACTTTGTGAAGGAACTAACAGATGTTCTTAAAGGACTA[C/T]AGATTTCCACATCAGCAGACAAACTCAGCAAGGTTTCACTTGAAGATTAGTTACAAATAAATGCTCAGGTATTTTGCTTGTGAGATTATTTACACTTTCTTATATTAACTTAGGCCAGAAAAAATGCATTCAACCATATCACAAACATGAAACTACGAAGTGAAAACATTGAGAAAGAAAAAGAGGACAAAGAAGAAGGAGAAGGAGAGAAAGAAGAAAGACAGAAGGAGAAGAACACAGAAACCGCAGAGACCGAATACACAGTTGAGGTCTGCATTAACATTATTTAGCCGTAAATAATGTAAATGTTATACACATGCACATATTTTACATTAAATAATCTGTTTTTATTAAGTTTTCATTGCATTGACTAAAGCTCTTTTTATAGGATGCCCATTTGTCTGCCATCACGAGTTTGGCCGAGTTCACAGCGAGGTCCATCGAGCAGTTCCACAAAACAGCTGAAATGTTGCTTTACTCTAACACTGAAGGGGCCGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39342
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110220 Essential Splice Site 349 520 8 13
ENSDART00000133585 Essential Splice Site 349 572 9 14
Genomic Location (Zv9):
Chromosome 21 (position 36751602)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37740951
GRCz11 21 37426138
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTCTTAAAGGACTACAGATTTCCACATCAGCAGACAAACTCAGCAAG[G/A]TTTCACTTGAAGATTAGTTACAAATAAATGCTCAGGTATTTTGCTTGTGA
Long Flanking Sequence:
AAATATATTCAATATATTTTATCGGATTGTATTGTATTGTATTTTATTGTGACAAGATGTTCAGTTTACACCCCTACTCAGTTTTAGTCATAGAACTCATACATGCTTTCTCAATGTGTGAGTACCAACGAGGTTTATTCTTGCATCACATGACAGATGTTTGAGCTTCTGCAAGGACCAATAAGCTTTGCTGATGTGTGTCAATATGTAAATAAAACATCCAATGAAACACATTCCTTATGTAGAGAAACAATTTGAATCTAATCAGTTTGGAAGCATGAGAGTTTCAGAGTGAAAAGACTTTAAAAGGACGGACCGAAATTTCTCCCATTTTATTAAAAATATCTTCCATGTGCTCCAAATGATGAACAAAAGTCACAGGTTTGCTCATATTATTATTTTTTTAATCCTCAGGTGATGATGGAGAGGACTTTGTGAAGGAACTAACAGATGTTCTTAAAGGACTACAGATTTCCACATCAGCAGACAAACTCAGCAAG[G/A]TTTCACTTGAAGATTAGTTACAAATAAATGCTCAGGTATTTTGCTTGTGAGATTATTTACACTTTCTTATATTAACTTAGGCCAGAAAAAATGCATTCAACCATATCACAAACATGAAACTACGAAGTGAAAACATTGAGAAAGAAAAAGAGGACAAAGAAGAAGGAGAAGGAGAGAAAGAAGAAAGACAGAAGGAGAAGAACACAGAAACCGCAGAGACCGAATACACAGTTGAGGTCTGCATTAACATTATTTAGCCGTAAATAATGTAAATGTTATACACATGCACATATTTTACATTAAATAATCTGTTTTTATTAAGTTTTCATTGCATTGACTAAAGCTCTTTTTATAGGATGCCCATTTGTCTGCCATCACGAGTTTGGCCGAGTTCACAGCGAGGTCCATCGAGCAGTTCCACAAAACAGCTGAAATGTTGCTTTACTCTAACACTGAAGGGGCCGCGGCCCCAGAACAAGCAAAAATCCTATCACAGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12732
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110220 Nonsense 454 520 11 13
ENSDART00000133585 Nonsense 454 572 12 14
Genomic Location (Zv9):
Chromosome 21 (position 36751013)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37740362
GRCz11 21 37425549
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAAATTWAAAKCAYSTGTGTTTCTCTTGCAGAGTCACCATTGTTATTTG[T/A]AAGGAGGTCTCACTGCTATCCAAAAAGTTTACAWCATGTTTGACTACCAT
Long Flanking Sequence:
AAATGCATTCAACCATATCACAAACATGAAACTACGAAGTGAAAACATTGAGAAAGAAAAAGAGGACAAAGAAGAAGGAGAAGGAGAGAAAGAAGAAAGACAGAAGGAGAAGAACACAGAAACCGCAGAGACCGAATACACAGTTGAGGTCTGCATTAACATTATTTAGCCGTAAATAATGTAAATGTTATACACATGCACATATTTTACATTAAATAATCTGTTTTTATTAAGTTTTCATTGCATTGACTAAAGCTCTTTTTATAGGATGCCCATTTGTCTGCCATCACGAGTTTGGCCGAGTTCACAGCGAGGTCCATCGAGCAGTTCCACAAAACAGCTGAAATGTTGCTTTACTCTAACACTGAAGGGGCCGCGGCCCCAGAACAAGCAAAAATCCTATCACAGTGAGTTATCCTGTTGAAGAAACTGCCTAACATTGTCCTTTTGAGAAATTTAAATCACCTGTGTTTCTCTTGCAGAGTCACCATTGTTATTTG[T/A]AAGGAGGTCTCACTGCTATCCAAAAAGTTTACATCATGTTTGACTACCATTGGGGTAGGATGCTTATCTTGCTTAAAAGACAGTCTGGAGATCTTTAATATTGTTTGTAAACATTAACTCTTGTGCATCTGTGTGAACATTTTACCTTTATCCATTTTATTGTTAGATTTGTTAATGCAGACAGCTCACATTTTGGCAAAAAAGGTTGCATTTTTATTGAAATTTACCTTCATAAATATTTTTCACTCGGTACAAAAATGTCCCAATTGAAACCCATTAAATCGGCAATATTTCATCACAGTGGCATATAAACAAAAATCAAGCCATTTTTGTTAACAGGCATTCATTTGTTTGGCTTCAACGATTTTACAAATGGTAAAATTTGGAATATTTTGTCAGCTTTGGTCTGTGGATTTGATTTTTACTGTTTCGGGCCAAATTGCAGGCCAAATTAAATATCTTATGTAGTTATGAATAATTAATTTTGCTGTTATGAAGAT
Associated Phenotype:
Not determined