Busch Lab

ZMP

mfn2

Ensembl ID:
ENSDARG00000079504
ZFIN ID:
ZDB-GENE-081105-44
Description:
mitofusin-2 [Source:RefSeq peptide;Acc:NP_001121726]
Human Orthologue:
MFN2
Human Description:
mitofusin 2 [Source:HGNC Symbol;Acc:16877]
Mouse Orthologue:
Mfn2
Mouse Description:
mitofusin 2 Gene [Source:MGI Symbol;Acc:MGI:2442230]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa13351 Essential Splice Site Available for shipment Available now
hu3528 Nonsense Confirmed mutation in F2 line Not yet available
sa21386 Nonsense Available for shipment Available now
sa34491 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13351
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108662 Essential Splice Site 104 757 2 17
ENSDART00000140266 Essential Splice Site 104 757 3 18
Genomic Location (Zv9):
Chromosome 8 (position 50073442)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47925419
GRCz11 8 47914411
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGGKGAAGTCCTGTCCCGAAGACACATGAARGTGGTCTTCTTTGGCAGG[T/C]ACRGTGCATAGATTTTGCCCCTCACAGAATAAACGCAAACATATGTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3528
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108662 Nonsense 285 757 7 17
ENSDART00000140266 Nonsense 285 757 8 18
Genomic Location (Zv9):
Chromosome 8 (position 50087109)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47939086
GRCz11 8 47928078
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGTTTTGTCAGGTGAGGCGGCAGCACATGGACCGCTGCACTAGTTTTT[T/A]AGTGGATGAGCTGCGGGTGGTGGATCGCTCTCATGCCGGGGATCGAATCT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21386
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108662 Nonsense 615 757 14 17
ENSDART00000140266 Nonsense 615 757 15 18
Genomic Location (Zv9):
Chromosome 8 (position 50099220)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47951197
GRCz11 8 47940189
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTATGGTTTCTATGGTGACAGGACTGGCATCACTCACCTCTCGGACAT[C/A]AATGGGCATCATAGTTGTTGGAGGAGTGGTAAGAACACACTGGATATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34491
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108662 Nonsense 752 757 17 17
ENSDART00000140266 Nonsense 752 757 18 18
Genomic Location (Zv9):
Chromosome 8 (position 50104863)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47956840
GRCz11 8 47945832
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATAAGGCGGGCTGGCTGGACAGTGAGCTCAACATGTTCATTCAGCAGTA[T/A]CTTCAACAGGGGCGATAAACTCCACAAGCCCTCAACAAGCTCCGTCGATC
Associated Phenotype:
Not determined