Busch Lab

ZMP

si:ch211-149l1.2

Ensembl ID:
ENSDARG00000079501
ZFIN ID:
ZDB-GENE-090313-40
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JM07]
Human Orthologue:
C2orf55
Human Description:
chromosome 2 open reading frame 55 [Source:HGNC Symbol;Acc:33454]
Mouse Orthologue:
2010300C02Rik
Mouse Description:
RIKEN cDNA 2010300C02 gene Gene [Source:MGI Symbol;Acc:MGI:1919347]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38293 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19581 Splice Site, Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3355
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108523 Nonsense 120 832 4 10
ENSDART00000136747 Nonsense 120 134 5 5
ENSDART00000140824 Nonsense 120 775 4 9
Genomic Location (Zv9):
Chromosome 1 (position 50194740)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49043921
GRCz11 1 49688341
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAAGCTGTTTATATTTCGTTTTGGCAGCTAAAACTACAACAGCAGAACT[T/A]ACATCTGGGTCCTCCTCCAATGCTGATTCCTGGAAAGCGCACAGAGGACT
Long Flanking Sequence:
ATAATATTGACCTTAAAATGTTTTATTAAAAAATGTAAAACTAATTTTATTCTCGCTGAAATAAAACAAATAAGACTTTTTTCAGAGAAAAAAATATTATCAGATATACTGTGAAAATTTTCTTGCTCTGTTAAACATCATTTGGAAAATATTTGAAAAAGAAAAAAAATGAACAGGAGGGTGATTAATTGTGACTGTATGTAATATATTTGAATAGCAAATAGATTAATACAACTCACTGAATCTGATCTGCAGGTATCCACAGGGTCTGAGCCCCAGAGCGCTGTCTCATGATAGCATCTTCTTCACGGATCAAACCCAGAGCACAGAACCCACACGAGTGCTTTCACAAGAGAACGTTCACGGCAAAATTAAAGCCTTACAAGTAAGTAAATGTTCTTTGTCAGCGTATTTTTTGGATCTACTCTTTAAGCAAAGTGTGCATCAGATACAAGCTGTTTATATTTCGTTTTGGCAGCTAAAACTACAACAGCAGAACT[T/A]ACATCTGGGTCCTCCTCCAATGCTGATTCCTGGAAAGCGCACAGAGGACTCGGGAGCCACTTCAGAGGATGATGGTTTACCTTGCAGCCCACCGGAAACCTACTTGTATGAGCGAGTGATGCATGGAGGCATTTACAAGGTTGCAGACTTTAACTTTGACCATTTGATTTGATTTGAGTTTAAACAAATAAATCATACACTTAAACAATTCTTTAAGCAAAATACATTTCATCATGGTCAAAATGGAGCGAAATGAAGCATAAACCTATTATTTTCCCCACCCCATTTCCAAACACATGCTTTTTCTGAAATGTAGCCCTATATACATTTCTGGAGATTGCGAATTATGTACCCAGAAGTAAGTATGGCTACATTTTATCTTTAAAACAAACGCTACAGGGTGGTATGATGCCATTCCTTTTTCGCGCTAGCAGCTTTCCGCTTACCACCGTATGGACGGCTTTCCCGCTGTTACCAGTTTGTCTAGTAGCTCGGTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38293
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108523 Essential Splice Site 166 832 4 10
ENSDART00000136747 None None 134 None 5
ENSDART00000140824 Essential Splice Site 166 775 4 9
Genomic Location (Zv9):
Chromosome 1 (position 50194880)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49044061
GRCz11 1 49688481
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCGGAAACCTACTTGTATGAGCGAGTGATGCATGGAGGCATTTACAAG[G/A]TTGCAGACTTTAACTTTGACCATTTGATTTGATTTGAGTTTAAACAAATA
Long Flanking Sequence:
TTTGGAAAATATTTGAAAAAGAAAAAAAATGAACAGGAGGGTGATTAATTGTGACTGTATGTAATATATTTGAATAGCAAATAGATTAATACAACTCACTGAATCTGATCTGCAGGTATCCACAGGGTCTGAGCCCCAGAGCGCTGTCTCATGATAGCATCTTCTTCACGGATCAAACCCAGAGCACAGAACCCACACGAGTGCTTTCACAAGAGAACGTTCACGGCAAAATTAAAGCCTTACAAGTAAGTAAATGTTCTTTGTCAGCGTATTTTTTGGATCTACTCTTTAAGCAAAGTGTGCATCAGATACAAGCTGTTTATATTTCGTTTTGGCAGCTAAAACTACAACAGCAGAACTTACATCTGGGTCCTCCTCCAATGCTGATTCCTGGAAAGCGCACAGAGGACTCGGGAGCCACTTCAGAGGATGATGGTTTACCTTGCAGCCCACCGGAAACCTACTTGTATGAGCGAGTGATGCATGGAGGCATTTACAAG[G/A]TTGCAGACTTTAACTTTGACCATTTGATTTGATTTGAGTTTAAACAAATAAATCATACACTTAAACAATTCTTTAAGCAAAATACATTTCATCATGGTCAAAATGGAGCGAAATGAAGCATAAACCTATTATTTTCCCCACCCCATTTCCAAACACATGCTTTTTCTGAAATGTAGCCCTATATACATTTCTGGAGATTGCGAATTATGTACCCAGAAGTAAGTATGGCTACATTTTATCTTTAAAACAAACGCTACAGGGTGGTATGATGCCATTCCTTTTTCGCGCTAGCAGCTTTCCGCTTACCACCGTATGGACGGCTTTCCCGCTGTTACCAGTTTGTCTAGTAGCTCGGTATGTGAAGTACGGACTGTACATGAGAGGAGAGGAGTTGACCATAACAACGGCAGGGCTTAATTTGTGTCGGAACAAGGATATGGATCCGGCACCTCTGAAATCTGATCCGGCACCTCATTTTACCGATCCCCCTCTAGACACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19581
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108523 Splice Site, Nonsense 745 832 9 10
ENSDART00000136747 None None 134 None 5
ENSDART00000140824 Splice Site, Nonsense 745 775 9 9
Genomic Location (Zv9):
Chromosome 1 (position 50204416)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49053597
GRCz11 1 49698017
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTAAGCTTTGATCCAAAAATATACATTAAAAGGAAATGTATTCTGTTAG[C/T]AGGACAACAGTAGGAACAATACCACCGAAGATGACACGACAAAGAGAACA
Long Flanking Sequence:
CAGGATGTACACTGAAAGAAATAATCCTTAGACAACAAAATGTACAGATGCATAATAACAAATATAATAAAATATAATAATAAATCATTCATTCATTTTCTTTTCGCCTTAGTACCTTTATTAATCTAGGGTCACCACAGCGGAATGAACCACCAAATTATCCAGCATGTTTTATGCAGCGGATGTCCTTCCAGCTGCAACCCATCACTGGGAAACACCCATACACTCTCATTCACACATATACACTACGGATAATTTACCTTTCCCAATTCAACTAAAGCTAGTGTTTGAGCTGTGGGGAGCACCCGGAGGAAACCCACACCAACACAGGGAGAACATCCAAACTCCATACAGAAATACCCACTGGTACAGCTAAGACTCGAACCAGCGACCTTCTTGCTGTGAGGCAACAGTGCTAACCACTGAGCCACCGTGCTGCACTAAACAACATCTAAGCTTTGATCCAAAAATATACATTAAAAGGAAATGTATTCTGTTAG[C/T]AGGACAACAGTAGGAACAATACCACCGAAGATGACACGACAAAGAGAACAGCGACTATTAGTAAGATGGATTTCAATGCAAGACCTGTTCCACCTAACAGCAACACCGAAGGTAAACACCGCTTTAACTGTTATGTGTTAATGTTAGTGGTGTTGATATTAATGTGTGTGCATGTATTTTCCTACAATAGCTCTTACCATCACATCTGATCCTCCTCCAGCAACGTCATCATCGTCATCATCATCACCTTCATCTCCAGCAGATGCCGTTGGAGCTCAGCCGTCCTGGATGGAGCTCGCCAAGAGAAAGTCTTTAGCGTGGAGCGACAAAAAAACTCTAGAATGAAGAAGAGATAAACAGTTGGAGACTGATGAAGTTGTGCAATACTAATGTTACAGGGAATGAATGAAGGAATGTGTGTGTGAACATGACTGAGTGTGTGTGTGATTGAGTTACACAGTTTATCACTAATAGAGTTTTTTAATTCTTATTTTTGTGTG
Associated Phenotype:
Not determined