Busch Lab

ZMP

fam125bb

Ensembl ID:
ENSDARG00000079478
ZFIN ID:
ZDB-GENE-080414-2
Description:
family with sequence similarity 125, member B [Source:RefSeq peptide;Acc:NP_001129949]
Human Orthologue:
FAM125B
Human Description:
family with sequence similarity 125, member B [Source:HGNC Symbol;Acc:23368]
Mouse Orthologue:
Fam125b
Mouse Description:
family with sequence similarity 125, member B Gene [Source:MGI Symbol;Acc:MGI:1919793]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa45330 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11811 Nonsense Available for shipment Available now
sa21338 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa45330
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109600 Essential Splice Site 105 273 3 9
ENSDART00000138921 Essential Splice Site 124 292 4 10
Genomic Location (Zv9):
Chromosome 8 (position 34377010)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 33519736
GRCz11 8 33528968
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACTGTTTGCCAGAGGGCTTCACTCCCATCCAAGACACCATGGATACCC[G/A]TAAGCATGGTTTCCTTCAGAAAATTCTGTTTTCTTTTTCATCCACTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11811
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109600 Nonsense 157 273 5 9
ENSDART00000138921 Nonsense 176 292 6 10
Genomic Location (Zv9):
Chromosome 8 (position 34369263)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 33511989
GRCz11 8 33521221
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACATATACATATTTATTTTCCACAGAGAGCTGAATGGTTTGGGGATTTG[G/A]TACCAGCTGGGAAAAGTCCCTAAGTCGCAKGACACAACACAGAAAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21338
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109600 Essential Splice Site 215 273 6 9
ENSDART00000138921 Essential Splice Site 234 292 7 10
Genomic Location (Zv9):
Chromosome 8 (position 34325744)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 33468470
GRCz11 8 33477702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTGTCAAGCCAGATTATGACGAAATCTACAACATCTACACCAAATCAG[G/A]TCAGTCCTTTTTTAAATATGACTAAACATTAGCTTATCAGCAATTGCAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27240
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109600 Nonsense 256 273 9 9
ENSDART00000138921 Nonsense 275 292 10 10
Genomic Location (Zv9):
Chromosome 8 (position 34269315)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 33412041
GRCz11 8 33421273
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACGGCAGAAGTCATCTTTTTTTTTTTGTCTGTTTGTTTGTTTTACAGTA[C/A]AAATATTGTTTCAACACTGAACACAGCGCTGCAGCTTTCACATGGAGCCA
Associated Phenotype:
Not determined