Busch Lab

ZMP

nlgn4a

Ensembl ID:
ENSDARG00000079455
ZFIN IDs:
ZDB-GENE-100309-2, ZDB-GENE-100309-2
Description:
neuroligin 4b [Source:RefSeq peptide;Acc:NP_001159803]
Human Orthologues:
NLGN4X, NLGN4Y
Human Descriptions:
neuroligin 4, X-linked [Source:HGNC Symbol;Acc:14287]
neuroligin 4, Y-linked [Source:HGNC Symbol;Acc:15529]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa32702 Nonsense Mutation detected in F1 DNA Not yet available
sa32703 Nonsense Mutation detected in F1 DNA Not yet available
sa39634 Nonsense Mutation detected in F1 DNA Not yet available
sa32704 Nonsense Mutation detected in F1 DNA Not yet available
sa18031 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25612
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113818 Nonsense 200 826 2 5
ENSDART00000128317 Nonsense 217 843 3 6
Genomic Location (Zv9):
Chromosome 1 (position 32129830)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 31844713
GRCz11 1 32577281
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAGTATTCTAGCCAGCTATGGAAACGTCATTGTAGTGACCCTGAACTA[T/A]AGGCTGGGAGTGCTGGGTAAGTCATTTGTTTTTCATTAAATGGTGGATGG
Long Flanking Sequence:
GCTGGGTCAGTTAGCATTTCTGTGTGTCTGCATAAAAATATAAATAAATAGAAAATGAAAAATACAGGGGTGCTAATATTTTAGGAGGGCTAGCAATTCTGACTTCAACTGTAAGTCTGATATAAGAATAGTTCACTGGGAGCATTTGTTTATGTCTAAATAAGGAATAATAATTTGTTTATATACCATAAATAAACTCAATTCATAAGTAGATTTCTATACATAAAAAAGGCTATAGAACATTTCTAGTAATTAGTGACTTTGTGGTTTAAAAGTCACATTTTACATTACCACAATATTATTGCAAATTGCACTAGTGTGTTTAGATGGTTTGTTTTTATTCCTCTTTTTTTTTGTCCTGCAGACATCCATGATGAGAATGGACTGAGACCTGTTATGGTGTACATCCATGGTGGATCCTACATGGAAGGAACAGGGAATATGATTGACGGCAGTATTCTAGCCAGCTATGGAAACGTCATTGTAGTGACCCTGAACTA[T/A]AGGCTGGGAGTGCTGGGTAAGTCATTTGTTTTTCATTAAATGGTGGATGGTTTTGATTGGGAGATATCTTGCTGACCTCCTGTTTTATATTCAGCCGGTTGCATGTGTAATAAAGATATATGGGTGTTTTAAGAGGCTCTTGATCTTGGAATTGCTGAGAAGGATATGGGTCATAGGCTTAAAAATTTAAAGAATATAAAATGAGGGTGCAAATCAGTTTAAATGGATTAGATGCAATATACTCAGATTCAAGCAAATATTCCTGAAAGTTTATTGTACTTAATGAAATAAAAGTTATGTAAAGTCAAACTCAGATGAAGGTGAACTTAAACTATTTGTTTTTAAGGAAATGTCTAGTTCAGCTTGAGAATCCAGAGTGAAATATGTTTTTTTTTTGTCTATGTTTTCATAAGAAATAATATGAAGAACATGGAGTTGTAATGTTCTGTTGTGTTTAAGGCTTTCTGGGCTTTTTGTTGTTTTTGTAGGGTTACAATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32702
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113818 Nonsense 351 826 4 5
ENSDART00000128317 Nonsense 368 843 5 6
Genomic Location (Zv9):
Chromosome 1 (position 32221580)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 31936368
GRCz11 1 32668936
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATTGCGTTTGGTCCAGTAATTGACGGTGACGTCATCCCAGATGACCCC[C/T]AAATTCTGATGGAGCAAGGGGAGTTCCTCAACTATGACATCATGCTGGGT
Long Flanking Sequence:
TAGTTGTGCTAGGTAGCCTTTGCAAAGGGTACCCAAAAAGTGGTATGGTATGGTTCGCTTGTAGGTACCTCTTGACAGTGGAAATGGCCAAACCGAACCGTACCACTCTGTACCACTCAGTGGAAACGCCCCTTAGAGGCTTTTGCATCTCAGCTGTTTAAATGCTATATATGTGTTTGTTTCATTTCATGTTTGTTTGTCTGAAATAACAATTTAATATTAATTGATTCTATCAATGTGTTTTATCTTCAGATTTGTTTCAGAAAGCCATCATCCAGAGTGGGACTGCTCTGTCTAGCTGGGCCGTCAACTACCAGCCTGCCAAATACACCCGGATACTAGCTGAGAAAGTGGGCTGTAATATGCTAGATAGCATAGACCTGGTGGAATGTCTACAGAACAAGAACTACAAGGAGCTGATTGAACAGTACATAACACAAGCCAAGTACCACATTGCGTTTGGTCCAGTAATTGACGGTGACGTCATCCCAGATGACCCC[C/T]AAATTCTGATGGAGCAAGGGGAGTTCCTCAACTATGACATCATGCTGGGTGTTAACCAGGGTGAGGGTTTTAAGTTTGTGGATGGCATCGTGGACAGTGAGGATGGTGTGTCTGCAAATGACTTTGACTTCGCCGTGTCTGATTTTGTGGACCATCTTTATGGTTATCCAGAGGGCAAGGACACGCTTCGAGAAACCATCAAGTTCATGTATACTGACTGGGCTGACAAGGAGAACCCGGAGACCAGGCGAAAGACTCTAGTTGCACTTTTCACTGATCACCAATGGGTGGCGCCAGCAGTAGCTACAGCAGACCTTCATGCTCAATATGGATCTCCAACATATTTTTATGCTTTTTACCATCATTGTCAGAGTGAAATGAAACCTAGCTGGTCGGATTCAGCACACGGAGACGAGGTGCCTTATGTGTTTGGAATTCCCATGCTTGGCCCCACTGATCTCTTTAATTGTAATTTCTCCAAGAATGATGTCATGCTTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32703
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113818 Nonsense 446 826 4 5
ENSDART00000128317 Nonsense 463 843 5 6
Genomic Location (Zv9):
Chromosome 1 (position 32221867)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 31936655
GRCz11 1 32669223
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGGAGACCAGGCGAAAGACTCTAGTTGCACTTTTCACTGATCACCAATG[G/A]GTGGCGCCAGCAGTAGCTACAGCAGACCTTCATGCTCAATATGGATCTCC
Long Flanking Sequence:
GCTCTGTCTAGCTGGGCCGTCAACTACCAGCCTGCCAAATACACCCGGATACTAGCTGAGAAAGTGGGCTGTAATATGCTAGATAGCATAGACCTGGTGGAATGTCTACAGAACAAGAACTACAAGGAGCTGATTGAACAGTACATAACACAAGCCAAGTACCACATTGCGTTTGGTCCAGTAATTGACGGTGACGTCATCCCAGATGACCCCCAAATTCTGATGGAGCAAGGGGAGTTCCTCAACTATGACATCATGCTGGGTGTTAACCAGGGTGAGGGTTTTAAGTTTGTGGATGGCATCGTGGACAGTGAGGATGGTGTGTCTGCAAATGACTTTGACTTCGCCGTGTCTGATTTTGTGGACCATCTTTATGGTTATCCAGAGGGCAAGGACACGCTTCGAGAAACCATCAAGTTCATGTATACTGACTGGGCTGACAAGGAGAACCCGGAGACCAGGCGAAAGACTCTAGTTGCACTTTTCACTGATCACCAATG[G/A]GTGGCGCCAGCAGTAGCTACAGCAGACCTTCATGCTCAATATGGATCTCCAACATATTTTTATGCTTTTTACCATCATTGTCAGAGTGAAATGAAACCTAGCTGGTCGGATTCAGCACACGGAGACGAGGTGCCTTATGTGTTTGGAATTCCCATGCTTGGCCCCACTGATCTCTTTAATTGTAATTTCTCCAAGAATGATGTCATGCTTTCGGCGGTGGTGATGACGTACTGGACAAATTTCGCTAAAACTGGGTAAGAGCATTTTATTTGAACTATAAATTAAAATTTAATACTGGATAACTAATCTAAGGTCTTAATCAGTTATATATACATATGATAGATAAGATATATAAGTCTACATAGTATTTTTTTTTGGAATCTTGTTTTGTTGCTGTTGCTTGTCTGTTTGTTTTAATTTCTTCAAAAATACATAACATATGAAATACCTACTTACAGTTATTTGGATCATGTTATACATATAATTTGTGTTATGTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39634
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113818 Nonsense 465 826 4 5
ENSDART00000128317 Nonsense 482 843 5 6
Genomic Location (Zv9):
Chromosome 1 (position 32221924)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 31936712
GRCz11 1 32669280
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGCAGTAGCTACAGCAGACCTTCATGCTCAATATGGATCTCCAACATA[T/A]TTTTATGCTTTTTACCATCATTGTCAGAGTGAAATGAAACCTAGCTGGTC
Long Flanking Sequence:
GAGAAAGTGGGCTGTAATATGCTAGATAGCATAGACCTGGTGGAATGTCTACAGAACAAGAACTACAAGGAGCTGATTGAACAGTACATAACACAAGCCAAGTACCACATTGCGTTTGGTCCAGTAATTGACGGTGACGTCATCCCAGATGACCCCCAAATTCTGATGGAGCAAGGGGAGTTCCTCAACTATGACATCATGCTGGGTGTTAACCAGGGTGAGGGTTTTAAGTTTGTGGATGGCATCGTGGACAGTGAGGATGGTGTGTCTGCAAATGACTTTGACTTCGCCGTGTCTGATTTTGTGGACCATCTTTATGGTTATCCAGAGGGCAAGGACACGCTTCGAGAAACCATCAAGTTCATGTATACTGACTGGGCTGACAAGGAGAACCCGGAGACCAGGCGAAAGACTCTAGTTGCACTTTTCACTGATCACCAATGGGTGGCGCCAGCAGTAGCTACAGCAGACCTTCATGCTCAATATGGATCTCCAACATA[T/A]TTTTATGCTTTTTACCATCATTGTCAGAGTGAAATGAAACCTAGCTGGTCGGATTCAGCACACGGAGACGAGGTGCCTTATGTGTTTGGAATTCCCATGCTTGGCCCCACTGATCTCTTTAATTGTAATTTCTCCAAGAATGATGTCATGCTTTCGGCGGTGGTGATGACGTACTGGACAAATTTCGCTAAAACTGGGTAAGAGCATTTTATTTGAACTATAAATTAAAATTTAATACTGGATAACTAATCTAAGGTCTTAATCAGTTATATATACATATGATAGATAAGATATATAAGTCTACATAGTATTTTTTTTTGGAATCTTGTTTTGTTGCTGTTGCTTGTCTGTTTGTTTTAATTTCTTCAAAAATACATAACATATGAAATACCTACTTACAGTTATTTGGATCATGTTATACATATAATTTGTGTTATGTACTTGTGATAAAATAACGTTATATATTTCAATATTTTTGTTTAATTTTTGAATTACATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32704
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113818 Nonsense 605 826 5 5
ENSDART00000128317 Nonsense 622 843 6 6
Genomic Location (Zv9):
Chromosome 1 (position 32243683)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 31958471
GRCz11 1 32691039
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAACTGGTACCTCATCTCCATAACATCAACGAACTCTTTCAGTATGTCT[C/A]GACCACTACAAAGATACCTCCTCAGGATACTACACCTTTCCCATACACTA
Long Flanking Sequence:
ATACTTATTGTAAGTCATATTACAGTTACTAACCTTTGTCATTGCATCACTGATTGTTTTTAAGTATAGTGAACAAAGAAAAAAAAAAATAGTTGGATCAGTTATAAGCATGAGTTTTTTAAGATGTCTGATGTCTTTCCCTTTCCACTACCCTTCTAACCAACATAGAATTGAATTCTGAGTAAAATGGAATTGGGCATTGCTCTGTAATGTTATAACACGCATTTCTGAAATATAGATATAAATGTTAATATTTATTTGTTTTTCCTCTCATTTTAGGGATCCGAACCAGCCAGTTCCACAGGACACCAAATTCATACACACAAAGCCCAACCGCTTTGAGGAAGTAGCCTGGTCGAAATACAACCCCAAAGACCAGCTTTACTTACACATCGGACTGAAGCCAAGGGTGAGAGATCACTATCGCGCCACCAAGGTTGCTTTCTGGTTAGAACTGGTACCTCATCTCCATAACATCAACGAACTCTTTCAGTATGTCT[C/A]GACCACTACAAAGATACCTCCTCAGGATACTACACCTTTCCCATACACTAAACGACTAGGTAAAACATGGCCATCCACCACACGACACCCTGGTGTTCCTCCTGCCAACACCAAACAAACCACAGACCAGCGTAAAGGCAATGATTTGAGTGATGACTCAGCAGTGGTTATCGAGACAAAGCGCGATTACTCGACCGAACTCAGTGTGACCATAGCAGTAGGTGCTTCTCTCCTTTTCCTCAACATTCTGGCATTCGCAGCGCTCTACTACAAGAAGGATAAACGTCGACATGAATCCAACCGACGAGGACCAAGCCCGCAGCGGAACTCTGCGCCAGCTAATGTGGTGGCTAACGCTAATGACATAGCACATTTGCAGAGTGATGAGCTGATGTCACTTCAGATGAAACAGCAGCAGATGGAACACGAGCACCATCATGAGTGCGATTCTTTACAAGCTCACGATACGCTTCGTCTTACCTGCCCGGCTGATTATACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18031
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113818 Nonsense 695 826 5 5
ENSDART00000128317 Nonsense 712 843 6 6
Genomic Location (Zv9):
Chromosome 1 (position 32243954)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 31958742
GRCz11 1 32691310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTGCTTCTCTCCTTTTCCTCAACATTCTGGCATTYGCAGCGCTCTACTA[C/A]AAGAAGGAKAAACGTCGACATGAATCCAACCGACGAGGACCAAGCCCGCA
Long Flanking Sequence:
CATTTTAGGGATCCGAACCAGCCAGTTCCACAGGACACCAAATTCATACACACAAAGCCCAACCGCTTTGAGGAAGTAGCCTGGTCGAAATACAACCCCAAAGACCAGCTTTACTTACACATCGGACTGAAGCCAAGGGTGAGAGATCACTATCGCGCCACCAAGGTTGCTTTCTGGTTAGAACTGGTACCTCATCTCCATAACATCAACGAACTCTTTCAGTATGTCTCGACCACTACAAAGATACCTCCTCAGGATACTACACCTTTCCCATACACTAAACGACTAGGTAAAACATGGCCATCCACCACACGACACCCTGGTGTTCCTCCTGCCAACACCAAACAAACCACAGACCAGCGTAAAGGCAATGATTTGAGTGATGACTCAGCAGTGGTTATCGAGACAAAGCGCGATTACTCGACCGAACTCAGTGTGACCATAGCAGTAGGTGCTTCTCTCCTTTTCCTCAACATTCTGGCATTCGCAGCGCTCTACTA[C/A]AAGAAGGATAAACGTCGACATGAATCCAACCGACGAGGACCAAGCCCGCAGCGGAACTCTGCGCCAGCTAATGTGGTGGCTAACGCTAATGACATAGCACATTTGCAGAGTGATGAGCTGATGTCACTTCAGATGAAACAGCAGCAGATGGAACACGAGCACCATCATGAGTGCGATTCTTTACAAGCTCACGATACGCTTCGTCTTACCTGCCCGGCTGATTATACGCTTACCCTGCGACGTTCACCTGATGACATCCCACTCATGACGCCAAGTACCATAACAATGATTCCTAACACTCTGGCCGGAATGCAGACCCTGCACAATTTCAACACATTCGGAGGCAGTCAGAACAGTACCAACTTGCCCCATGGGCATTCCACCACCAGGGTATAGCTTCTTTTTTTTTTTAGAACTACAGAACATGGTCTGCTAAGGCAGTGGGGGATAAAGGACCTTTGTTTGTTATGGCAAACTGTGCTGACTTTGTTCCACTCTGA
Associated Phenotype:
Not determined