Busch Lab

ZMP

coro2ba

Ensembl ID:
ENSDARG00000079440
ZFIN ID:
ZDB-GENE-050518-1
Human Orthologue:
CORO2B
Human Description:
coronin, actin binding protein, 2B [Source:HGNC Symbol;Acc:2256]
Mouse Orthologue:
Coro2b
Mouse Description:
coronin, actin binding protein, 2B Gene [Source:MGI Symbol;Acc:MGI:2444283]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20987 Nonsense Available for shipment Available now
sa34108 Nonsense Mutation detected in F1 DNA Not yet available
sa20988 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20987
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084530 Nonsense 158 491 4 12
Genomic Location (Zv9):
Chromosome 7 (position 34663103)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33057443
GRCz11 7 33328593
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCATCGAGTGGCATCCAACAACTAGCGGGATTCTCTTTAGTGCTGGCTA[T/A]GACTACAAGGTAAGGACAATTTGTGTGACACAATCTGATCAACTTAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34108
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084530 Nonsense 160 491 4 12
Genomic Location (Zv9):
Chromosome 7 (position 34663109)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33057449
GRCz11 7 33328599
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTGGCATCCAACAACTAGCGGGATTCTCTTTAGTGCTGGCTATGACTA[C/A]AAGGTAAGGACAATTTGTGTGACACAATCTGATCAACTTAAACTCACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20988
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084530 Nonsense 410 491 11 12
Genomic Location (Zv9):
Chromosome 7 (position 34672533)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33066873
GRCz11 7 33338023
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTCATGTCCTTAAAAGAGGGCTACAACAGACCCAACAAGCTGGTGTTC[A/T]AAGCACCCGTGAAGGAGAAGAAGGGTGGAGTGGTCAATGGCATTGACCTG
Associated Phenotype:
Not determined