Busch Lab

ZMP

si:ch211-208h7.4

Ensembl ID:
ENSDARG00000079434
ZFIN ID:
ZDB-GENE-030131-6110
Human Orthologue:
KIAA0922
Human Description:
KIAA0922 [Source:HGNC Symbol;Acc:29146]
Mouse Orthologue:
D930015E06Rik
Mouse Description:
RIKEN cDNA D930015E06 gene Gene [Source:MGI Symbol;Acc:MGI:2443399]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa10363 Essential Splice Site Available for shipment Available now
sa32680 Nonsense Mutation detected in F1 DNA Not yet available
sa7366 Missense Mutation detected in F1 DNA Not yet available
sa31205 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10363
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111426 Essential Splice Site 354 1546 10 34
ENSDART00000133208 Essential Splice Site 353 1545 10 34

The following transcripts of ENSDARG00000079434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24138638)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24590409
GRCz11 1 25281238
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATAGGAGTGTTCATGTTGAACTCAGGTGTTAAAAAGCTCTTTGTTAAGG[T/A]ATGTGCACGTACATTGACATTGTTTTAACGTTTTTAATTATGTATGTATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6584
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111426 Essential Splice Site 390 1546 11 34
ENSDART00000133208 Essential Splice Site 389 1545 11 34

The following transcripts of ENSDARG00000079434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24138856)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24590627
GRCz11 1 25281456
KASP Assay ID:
554-5401.1 (used for ordering genotyping assays)
KASP Sequence:
AAGCCTTCTGCTACTAACTTCACTCAAGTGGCTTCACTCTTCTGTAGACG[T/A]CAGTATTYTACTCTCCACATTTAATTTTSACATTGTACATGCTACAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32680
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111426 Nonsense 798 1546 22 34
ENSDART00000133208 Nonsense 797 1545 22 34

The following transcripts of ENSDARG00000079434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24151701)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24603472
GRCz11 1 25294301
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCAGGCGAGTTGCCGCTGACTGTAGTGTCCATGAACATTAATGGATAT[A/T]AATGTCAGGGTTATGGTTTTGAAGTGCAGCACTGTGGATCCTTCAGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7366
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111426 Missense 1313 1546 30 34
ENSDART00000133208 Missense 1312 1545 30 34

The following transcripts of ENSDARG00000079434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24168299)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24620070
GRCz11 1 25310899
KASP Assay ID:
554-4196.1 (used for ordering genotyping assays)
KASP Sequence:
TGACAGAGAACCATACCAAAGCTCAGAAATGGGTCCWGTCCCAGCACTTC[C/A]TCACACCTTCGCWGATGTAGCTGCAGGTGTGGACAAAAACATCGGTAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31205
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111426 Essential Splice Site 1371 1546 31 34
ENSDART00000133208 Essential Splice Site 1370 1545 31 34

The following transcripts of ENSDARG00000079434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24170541)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24622312
GRCz11 1 25313141
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGAATCTCTCCCGTTTGTCCCTCAGAATCCCTCATCCAGATATGATGGG[T/C]ACGTCTCCAGCTTCTTTCTACTTATCTAGCATTTTTTTTTCTTCACATAA
Associated Phenotype:
Not determined