Busch Lab

ZMP

tpsn

Ensembl ID:
ENSDARG00000079402
ZFIN ID:
ZDB-GENE-990714-21
Description:
tapasin [Source:RefSeq peptide;Acc:NP_571049]
Human Orthologue:
TAPBP
Human Description:
TAP binding protein (tapasin) [Source:HGNC Symbol;Acc:11566]
Mouse Orthologue:
Tapbp
Mouse Description:
TAP binding protein Gene [Source:MGI Symbol;Acc:MGI:1201689]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36774 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36774
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066173 Nonsense 325 433 6 9
ENSDART00000104845 Nonsense 334 442 5 8

The following transcripts of ENSDARG00000079402 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 7662678)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7121217
GRCz11 19 7040142
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCTCCTCACACTCTGGATCTGGGCTGGGAGTTTACCGGGGCTGATGGG[A/T]AGTCCCTCTCTCTGGGTCAGGGCAGTGTAACGGGTCACAGACGGGCGTCT
Long Flanking Sequence:
CTTGACTGCAACCATATCTACAATAGTGACCTCTGTCTCTCCTCTCTCCAGAGCCTTCATCTCTCTCCATGTTCTTCTTTTCCTCTGCTGGCTTCATCTGTATTTATTATATTAATCTACTGTCATATCTACAGTAATAACTTCTGTCTTTCTTCTTTCTGCAGAGTCTCAATCTCTCTCCATCCATCCTTCTCCTCTGTATTTGTTATATTAATCTATAGTCACAATAATCATCTCAGTCATTAATCATCTCAGTCTTCTCTCTCTCCATGTTCTACTTTTGTTCTGCTGGGTTTATCTGTATTTATTATATTAATCTACAGTCGTATCTACAGTAATAACCCCTGTCTCTTCTTTCTCCAGAGCCTCCATCTCTCTCCATCCTCCCCTCTCCTCTTCCTCTGCTGGTCCCGGGACAGGTGCTGTCGGTTCAGTGTGAGGCGTCTGGTTTTGCTCCTCACACTCTGGATCTGGGCTGGGAGTTTACCGGGGCTGATGGG[A/T]AGTCCCTCTCTCTGGGTCAGGGCAGTGTAACGGGTCACAGACGGGCGTCTGATGGCACCTTCAGTCAGAGCAGCCGTCTGGAGCTCGACTCCACTAAACTGAGACTCGCTCGGGGCGGAGAGATCAGCTGTGTGGCCAAACATGACGGAGGAACACGACGAGCCTCTGCTGCACTCAATGTCATCGGTGAGATATAACTTTATACAGTTAAATTTATTAACCCTCCTGTGAAATTTCAATTTTAAATTAAATAGTCTTTAAATTGACTTTTTAATTTATATATAATTTGTATCATATACATATATATTTTATATCTAAATATAATTAACATTTTCTCAAACAAATGTATTCATTTCAAAGTAAAAAGTCCTGCTTCCTTAATTTTTTTTGTTAACTTTTCTAGTTATCTTAACTTCCATCAATCAAACTGACAGAAAATATCAAGTTAAACTTTATATAACTTAAAAACATTTAGATGAAACCTGATAAACTAACTAGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4784
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066173 Essential Splice Site 430 433 None 9
ENSDART00000104845 Essential Splice Site 439 442 None 8

The following transcripts of ENSDARG00000079402 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 7661623)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7120162
GRCz11 19 7039087
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATGTAAATTTCCATGCAGACTCCGGTKACTCTGAATTAAATGAWAAGG[T/C]SAGTTTTGTTTCTCTAAKCTCTAAACASCACTTTCAMTTTCAATTTTATT
Long Flanking Sequence:
AAATGTACACAGTACACACGCTTTCGATAACTACAGTCAAAACAGACTTTTATTTTGTAATGTGGTTAATAGCGATTCATTTTCGCCCAGCACTAATAATAATGTATGTTCATGTGATTGTGTAGCGACTTGTTTTAGATCATGTCTTACAATATTTGACTTGCATTTAATCTATATATTATTTTATACTTATGTGCTTATTTTATTTATTATGATTATGTTGTTGTTGTTGATTTTAGGTGTCGCAGCTCCATCTATTGAGGACTCGATGGCGATGGTCGCTGTTGCTCTTCTTCTTTATGGCATGATCAAGTTTCTCTCCTGGACATTCAGCTCTTCTGGTGAGTTTAAAGCATGACAGTAAACTTACACTAGTCGCTGTGTGTGATTAGGAGATTATGAGATCACTGTTAAACATACAAACATGTCCATTTAAATGTAGTTATTAATAAATGTAAATTTCCATGCAGACTCCGGTGACTCTGAATTAAATGATAAGG[T/C]GAGTTTTGTTTCTCTAAGCTCTAAACACCACTTTCACTTTCAATTTTATTGAAAAAGATTTTATTAAGAACATTTTGTCTGATCATTGTGTTTCTGTTTGATCTTTAGAAGGAAAAATAAACCTGGATCTGGGATTTTTCATCTCGTCTCAAGCTCTCTGTGAAGCAGTTTTTATTGTTTTTATTTCTGTTTTTATTGTTCTCCTGAAAAGTCGTCTGAACAATTTACAGTAAAATGTTTGTAAATAATCAGATTGACATTAGGATTTTTAGACTGCTGTATCGGTGTTTGGGATGCTTTCTCTGTGTTGTAGTATTTTATATAGACTGATTTTAATGCTGGGTGTACAGATGCTGAAAATAAAAATATTAAACATACATTTATGATTGTTTAATTGTATGATTTATTTCTTTTTAATATTACACAATATCTATTTAATAATACACAACCCTTTGGGACAATGAGTTTTTTGTTAGGTGAAGAGATCTATCTATCTATCT
Associated Phenotype:
Not determined