Busch Lab

ZMP

si:dkey-33l14.1

Ensembl ID:
ENSDARG00000079374
ZFIN ID:
ZDB-GENE-090313-308
Human Orthologue:
TJP1
Human Description:
tight junction protein 1 (zona occludens 1) [Source:HGNC Symbol;Acc:11827]
Mouse Orthologue:
Tjp1
Mouse Description:
tight junction protein 1 Gene [Source:MGI Symbol;Acc:MGI:98759]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa44339 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15532 Nonsense Available for shipment Available now
sa13104 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30291
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112588 Nonsense 225 1689 6 27
ENSDART00000139840 Nonsense 224 361 6 8
Genomic Location (Zv9):
Chromosome 25 (position 33198960)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31809563
GRCz11 25 32220524
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGCTAACATGCTGCATGTGTTTCTGCGGTTTACTCTGTAAGCAGAATA[C/G]GGGCTTCGCCTGGCCAGCCACATCTTCGTGAAGGACATTTCCCCCGAGAG
Long Flanking Sequence:
GCCCCAGACTGATGCATAGTACCTTAATCTAATATTAAGCAGCATGTCTTGCATATTGATGCACGTCTCCGAAACCCGACAGGAGGACAAATCTGAACTTGTTTTATTTCAATGTATATAAATATGCATAAAATAAATGATACTGTTAATAGTAATAAGATTATACTAATGCAAATTGTTGTGAATAAACTGAAAATTACAGTTGCGCTGGTCTGAAAATAGCAACAAATCGCGCCAAATACGTCTTGCGCCTTATTACGCCGGGTGTATGATAGGGTCCATAATCTGCGATCAAACTGATTTGCTGTGATCTAAACATGCATTGCTAGCCAATCAGAATCCGACCCCCACATCACTACTAAATAAGTAATCTAGTAGTGGCATGTGCGCAGTTTTAAAGCCAGAAAACAGGTTTCCGTCAGAAAAAATGAGTGGCGCTGCTGACTAACATATGCTAACATGCTGCATGTGTTTCTGCGGTTTACTCTGTAAGCAGAATA[C/G]GGGCTTCGCCTGGCCAGCCACATCTTCGTGAAGGACATTTCCCCCGAGAGCCTGGCAGCCCGAGACGGAAACATCCAAGAGGGAGACGTGGTGCTTAAGGTAAGAGCACTCAAAACACCTGTTGGAGAGCGCAGACAGATGGAGCAAGACAAGTGATGAGCGCCGACCTAGAGTGACGGATTTTACTCGGACTTTATTTACTCTTCATGTAGATTAATGGCACGGTAACAGAGAATTTGTCCCTGATCGATGCTAAGAAGCTGATCGAGAGGTCAAAGGGAAAGCTGAAGATGGTGGTGCAGAGAGACGAGCGGGCGACGCTGCTGAACATCCCCGATCTGGACGACAGCATACCTTCTGCTAATGCCTCGGACAGAGATGGTGAGAGAGTCTCCAATGCGGATTGTTTATTCATTCATTCATTCAATTTCTTTTTGGCTAAGTCCCAGTCTTTTGGATGATACGTTAAGCCTAGGTCCTGACTCTCTGTGGTCATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44339
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112588 Essential Splice Site 528 1689 12 27
ENSDART00000139840 None None 361 None 8
Genomic Location (Zv9):
Chromosome 25 (position 33215775)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31826378
GRCz11 25 32237339
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCCCAAAGGAGAGGAGGTCACCATCCTGGCCCAGAAGAAGAAAGACG[G/A]TGAGGAGATGATTTGTCAATGCTTAAAGGGATAACCAAAACCTAATATTC
Long Flanking Sequence:
AAGGGAGATCTGGTGTTCCCGGCTTTTATAACCTTCTGTTTATGGGCTCTTTAATGGCAGTGCTAGTTTTATGGCGGTTCCCGCTTCCAAAACGTCCCTCTCGTGCTGTATAGATGCCGTTAAACCTCAGTGTGTGTGGAGATGTTTGCCCTCTCTCTGGAAGGTTTCCCCGGTGACTCTTTGCTGCCAAACGCAGGTTCTTTCTGTGGCTTTCTGGGTTTTTCCAACATGCCTGTTCTTTATTCAGAGCGTCTGTCACCTTCGCTTTCACACAAACCCTCAACGCCCACCGCACATTCACACTTTTCACAAACCTGTCCCAAGAAGTTTCCTCTCCTTCCTTTCAGAGGTTTTGTTGTTTTGTGCTAAGTGGCTTTTTAACTCTTTCCAGGTAAATAATGTGGATTTTGCAAATATCATCCGAGAGGAGGCAGTGCTGTTCCTGCTGGATCTGCCCAAAGGAGAGGAGGTCACCATCCTGGCCCAGAAGAAGAAAGACG[G/A]TGAGGAGATGATTTGTCAATGCTTAAAGGGATAACCAAAACCTAATATTCTGTTGGAAACCTATAACCATTTGTTTTTCCTACTATGGAAGTCAGTGGTTACCGGTTTTCAGCTTTCGTCAATATGTCTTGTTTTGTGTTCAGCAAAAAAAATGGACTGAAATAGGTTTAAAACAAATAAAGGCTGAGTGAATGGTGTCAGTGTTCAGTTTTGGGTGAACTATACCTTTAAGGAGGGAATCCCTTTTTTGCAACCTATTCCAAAAACTGGAACTCATCACTTTATTTTTACATTAGCAATTAGAGCTAGGTGTTATGACAATAAGACTTATTTATAAAGCTTTACTTAATTCAATATCAATTAATATTTCACTGAAAGTGTGAGTTTTGCAGATATGTAATTCATATGTAAATATAAATACCAGGCCCGGATTGGCTAATCGGGAGGACCGGGAGAATTCCCGGTGGGCCGGTCGTTTTTTTGGCCGTGAGGGCCGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15532
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112588 Nonsense 635 1689 14 27
ENSDART00000139840 None None 361 None 8
Genomic Location (Zv9):
Chromosome 25 (position 33218101)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31828704
GRCz11 25 32239665
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGGGATCGCGCCGACTTCTGGAGATTCAGAGGCCTCCGCAGCTCCAAR[C/T]GAAACCTGAGGAAGAGCAGAGARGACCTGTCTGCTCAGCCGGTCCAAACC
Long Flanking Sequence:
TAAAAGCGCTATACGAATAAAGATGAATTGAACTGAATTAATAATAATTTCATTATTTGATTAAATAAAGCTAATAATGAACCTCTTTGCTTGGCAGTGTACCGCCGCATTGTAGAGTCTGACGTGGGAGACTCGTTCTACATCAGGACTCATTTTGAATATGAGAAGGAGTCGCCCTATGGCCTGAGCTTCAATAAGGGGGAGGTCTTCAGAGTCGTCGACACCCTTTACAATGGCAAACTGGGCTCCTGGCTCGCCATCCGCATCGGCAAAAACCACCAGGAGGTGGAGCGGGGCATCATCCCCAACAAGAACAGGTGAGCGTGAAGCTGGTTTTTGCTAGAGGTGTGTGTTGATATATGTTGAGTTGCTCAAGACTGTTGTGTTCTTGTGTTTCCTGCAGGGCTGAGCAGTTATCAAGTGTCCAGTACACTCTCCCAAAGACTCCAGGAGGGGATCGCGCCGACTTCTGGAGATTCAGAGGCCTCCGCAGCTCCAAA[C/T]GAAACCTGAGGAAGAGCAGAGAAGACCTGTCTGCTCAGCCGGTCCAAACCAAATTCCCTGCTTATGAAAGAGTGGTGCTTAGAGAAGGTACAGCGCCTGCCTGCTTTTATATCAGATTTCAGCATCCATTTTTAGAGCTTTGTTAATCTGTTTAGTTTGTCTGTCACAAGTAGGATTGTCTGAAGTATCGACTTCGGTACTAATAAGAACCGAAATGTTAAAAACATCCATTTCCTGCTAACATTTAGCGCTGTTCTTAAACACTGCTGATTGGTCATTGTGTTCACATCAAATGACTGTGATTGGCTGTAAAGGTTTACCACTATGTGTTGACATATGAGCGATCTGCTGATGTGTTCTTGTATCTGTGTTTGCACTCAGTGAACAGTGGTAATTAGTTCTGAAAACCGTTACTATTTTTGGCAATTATTATTTAGTTTCAGTTTGTTCTAAAGGTCTTTGCACACTGAAGTCTGAAATTTTCGTATCCTTTCCGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13104
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112588 Nonsense 1310 1689 22 27
ENSDART00000139840 None None 361 None 8
Genomic Location (Zv9):
Chromosome 25 (position 33236071)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31846674
GRCz11 25 32257635
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGAAACCTCAGACGCGTGTTGGGGACGATGTGGTTCGCTCCAACCACTA[C/A]GACCCTGATGATGATGAAGAGTACTACAGAAAACAGCWMTCRTTTTTCGA
Long Flanking Sequence:
TAAATATTTATATAGAATATCAGTTATATAAATATGTAAATATTTTGATATTAAATAATATAAATATTTTATTTATGTACATTTTATTTCGTTGTAGACTATATTTATGCACAGTAAGTGCACACACATTATGTAAATACACACATCATGTAAATATGTACATTTCAGAGATTTAGCTAGAGAATGGGAACTGTGTAGTAAAGATGTAAATGTTACTTTGCATTGCCACAAAAGGTTTTGAAATGTGTGATATATAGTTGCATTCTCTTTCTCCCCACTCTTCTACACCATATTCACCCATCAGTCATGTATTGTTAGTGGAGTGTGCTCATGTAATCCTGTAGTGCCCTCTGCTGGCTGATCGTACTTTCTGGAAAGCATCATTAGATGTTACATAACATTTTGATCTTCTGCTGATGTTCCTGCTGTTTTCGTAGAGCTCCAGAGCCGCAGAAACCTCAGACGCGTGTTGGGGACGATGTGGTTCGCTCCAACCACTA[C/A]GACCCTGATGATGATGAAGAGTACTACAGAAAACAGCTCTCATTTTTCGACCGCCGCAGTTTCGACAGTAAGGTCATGAATCCACCCAGCGCTGGAGTAAACCGCTTCCATGAGCCGCCCAAACCACCCCAGACACAGATCGCTTATCCTTTCGCTAGGTAAAGGCCAGACAGGATATACTGTACATGTGTTTGTGTTGATGTTGATGAATGCATCACATCTACTGTTTCTGCTTCAGGACGGAGTCTGTGGAGAAGGTGAGTCCTGTGGACAAGAGATACGAGCCTCTGCCGCCAGTCAACCCTTCACCTGCTCCATACAGCCAGAACACACCTGTCGCTCCGCCCACATCCCTGCCCAAACTCACCAACATCGAGGGTAACAAGAGACTTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTGTTGTGTTGTGTTGTGTTGTGTTGTGTTTTGGTTTTGTTTTGTTTGGTTTTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8065
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112588 Nonsense 1378 1689 23 27
ENSDART00000139840 None None 361 None 8
Genomic Location (Zv9):
Chromosome 25 (position 33236353)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31846956
GRCz11 25 32257917
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTTCAGGACGGAGTCTGTGGAGAAGGTGAGTCCTGTGGACAAGAGATAC[G/T]AGCCTCTGCCGCCAGTCAACCCTTCWCCTGCTCCATACAGCCAGAACACA
Long Flanking Sequence:
CTACACCATATTCACCCATCAGTCATGTATTGTTAGTGGAGTGTGCTCATGTAATCCTGTAGTGCCCTCTGCTGGCTGATCGTACTTTCTGGAAAGCATCATTAGATGTTACATAACATTTTGATCTTCTGCTGATGTTCCTGCTGTTTTCGTAGAGCTCCAGAGCCGCAGAAACCTCAGACGCGTGTTGGGGACGATGTGGTTCGCTCCAACCACTACGACCCTGATGATGATGAAGAGTACTACAGAAAACAGCTCTCATTTTTCGACCGCCGCAGTTTCGACAGTAAGGTCATGAATCCACCCAGCGCTGGAGTAAACCGCTTCCATGAGCCGCCCAAACCACCCCAGACACAGATCGCTTATCCTTTCGCTAGGTAAAGGCCAGACAGGATATACTGTACATGTGTTTGTGTTGATGTTGATGAATGCATCACATCTACTGTTTCTGCTTCAGGACGGAGTCTGTGGAGAAGGTGAGTCCTGTGGACAAGAGATAC[G/T]AGCCTCTGCCGCCAGTCAACCCTTCACCTGCTCCATACAGCCAGAACACACCTGTCGCTCCGCCCACATCCCTGCCCAAACTCACCAACATCGAGGGTAACAAGAGACTTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTGTTGTGTTGTGTTGTGTTGTGTTGTGTTTTGGTTTTGTTTTGTTTGGTTTTGTGGTCTGTTGTTTTATTTATTTTTGTTGTTTTGTTTTTTGTTTTGGTTTTGATTTGGTGTTTTATTAATTTTTTTGTTGTTTTGTTTTGTTTTTTGGTTTGTTTTTTGTTTTGGTTTAGCATTTTATTTATTCATTTTTTCTGTTTTGGTTTGTTTTGTTTATGTTTTGTTTGTTTATTTTTTCTGTTTGTTTTCATTTGGGTGTTTAAGTTTGGTTTGGTGTTTTTTTTTTGGTTTGGTCTTTTATTTATTCATTTATTTATTTTTGTTTTATTTTTTGTTT
Associated Phenotype:
Not determined