Busch Lab

ZMP

LRIG3

Ensembl ID:
ENSDARG00000079363
Description:
leucine-rich repeats and immunoglobulin-like domains 3 [Source:HGNC Symbol;Acc:30991]
Human Orthologue:
LRIG3
Human Description:
leucine-rich repeats and immunoglobulin-like domains 3 [Source:HGNC Symbol;Acc:30991]
Mouse Orthologue:
Lrig3
Mouse Description:
leucine-rich repeats and immunoglobulin-like domains 3 Gene [Source:MGI Symbol;Acc:MGI:2443955]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39025 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12526 Nonsense Available for shipment Available now
sa7233 Nonsense Mutation detected in F1 DNA Not yet available
sa7234 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39025
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110613 Essential Splice Site 264 913 6 22
Genomic Location (Zv9):
Chromosome 15 (position 3027575)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3002582
GRCz11 KZ115982.1 13761
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCGAGGACATGAACGGCCCCTTCTCTGCTCTGGACAACCTGCGCAAACT[G/A]TACGCTTCCACAAACTCCATTAGTTTTTAATCTGAATTGTTGTAAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12526
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110613 Nonsense 801 913 20 22
Genomic Location (Zv9):
Chromosome 15 (position 3035384)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3010391
KASP Assay ID:
554-5045.1 (used for ordering genotyping assays)
KASP Sequence:
RATCRCTGATTGGCTCCTATGCCAGAAGGYGGGCTTTWKTTGCCATATAT[C/T]GATCGCTGATTRGCTCCTATGCCAGAAGGYGGGCTTTATTTGCCATATAK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7233
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110613 Nonsense 801 913 20 22
Genomic Location (Zv9):
Chromosome 15 (position 3035384)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3010391
KASP Assay ID:
554-5045.1 (used for ordering genotyping assays)
KASP Sequence:
RATCRCTGATTGGCTCCTATGCCAGAAGGYGGGCTTTAKTTGCCATATAT[C/T]GATCGCTGATTRGCTCCTATGCCAGAAGGYGGGCTTTATTTGCCATATAK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7234
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110613 Nonsense 818 913 20 22
Genomic Location (Zv9):
Chromosome 15 (position 3035435)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3010442
KASP Assay ID:
554-5046.1 (used for ordering genotyping assays)
KASP Sequence:
GATCGCTGATTRGCTCCTATGCCAGAAGGYGGGCTTTATTTGCCATATAK[C/T]GATCRCTGATTGGCTCCTGTACTASAANGGCGGGGCTTTTCARTTGTTTT
Associated Phenotype:
Not determined