Busch Lab

ZMP

abcg2b

Ensembl ID:
ENSDARG00000079361
ZFIN ID:
ZDB-GENE-050517-36
Description:
ATP-binding cassette, sub-family G (WHITE), member 2b [Source:RefSeq peptide;Acc:NP_001034155]
Human Orthologue:
ABCG2
Human Description:
ATP-binding cassette, sub-family G (WHITE), member 2 [Source:HGNC Symbol;Acc:74]
Mouse Orthologues:
Abcg2, Abcg3
Mouse Descriptions:
ATP-binding cassette, sub-family G (WHITE), member 2 Gene [Source:MGI Symbol;Acc:MGI:1347061]
ATP-binding cassette, sub-family G (WHITE), member 3 Gene [Source:MGI Symbol;Acc:MGI:1351624]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa45063 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45063
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091798 Essential Splice Site 470 618 11 17
Genomic Location (Zv9):
Chromosome 1 (position 7755050)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7994855
GRCz11 1 8678966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCATTGTCCCGATTTTAATCTTCTCCAGCATTTCCTACTACATGATGG[G/A]TAAAACAATCTCTGTTTCACATAAAACTGTGATTAAACGTCAACATCAGC
Associated Phenotype:
Not determined