Busch Lab

ZMP

si:dkeyp-8h3.5

Ensembl ID:
ENSDARG00000079350
ZFIN ID:
ZDB-GENE-030131-1423
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JIH9]
Human Orthologues:
RP11-159G9.5, ZNF654
Human Descriptions:
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JYP6]
zinc finger protein 654 [Source:HGNC Symbol;Acc:25612]
Mouse Orthologue:
Zfp654
Mouse Description:
zinc finger protein 654 Gene [Source:MGI Symbol;Acc:MGI:1919270]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9791 Nonsense Available for shipment Available now
sa31213 Nonsense Available for shipment Available now
sa17903 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9791
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114384 Nonsense 413 1614 8 9
ENSDART00000147703 None None 304 8 9
Genomic Location (Zv9):
Chromosome 1 (position 33288474)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32923225
GRCz11 1 33655793
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCCTGATCAACAGTACYATGTAGACACTGGTCTTGTRGGCAACAGTGTA[C/T]GATTTGAGGTTCTCCAGATCCTTAAAAAAGACCTGTATTTTGACCCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31213
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114384 Nonsense 727 1614 8 9
ENSDART00000147703 None None 304 8 9
Genomic Location (Zv9):
Chromosome 1 (position 33289416)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32924167
GRCz11 1 33656735
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATATTCAAGACCTGTTGAATTAGAAAAAATATCATTCAACAGTTTACCC[A/T]GAGAGCAAGAAGCTAAGCTGAACCATAATGAATCCAAAGAAGAAAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17903
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114384 Nonsense 756 1614 8 9
ENSDART00000147703 None None 304 8 9
Genomic Location (Zv9):
Chromosome 1 (position 33289503)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32924254
GRCz11 1 33656822
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
WAGAAGAAAGTGTGGYTACAGAGCAACTGTGTGAACCTGCAGAGAGCCCT[G/T]AAGTTGTTRAACATGTTAAACAGTCTGTCGAAATTAAGTCTACACCAATC
Associated Phenotype:
Not determined