Busch Lab

ZMP

GRIN2B (2 of 2)

Ensembl ID:
ENSDARG00000079348
Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 2B [Source:HGNC Symbol;Acc:4586]
Human Orthologue:
GRIN2B
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 2B [Source:HGNC Symbol;Acc:4586]
Mouse Orthologue:
Grin2b
Mouse Description:
glutamate receptor, ionotropic, NMDA2B (epsilon 2) Gene [Source:MGI Symbol;Acc:MGI:95821]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa19927 Nonsense Mutation detected in F1 DNA Not yet available
sa25970 Nonsense Mutation detected in F1 DNA Not yet available
sa33073 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19927
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047094 Nonsense 201 1263 7 25
Genomic Location (Zv9):
Chromosome 3 (position 2077361)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1544538
GRCz11 3 1319700
KASP Assay ID:
2259-2928.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGTGGGTAAGTGGGAGAACGGCTCTCTCTCCATGAAGTATCACGTGTG[G/A]CCGAGGTTTGAGCTGTACTCTGGGCCGGAGGCTCGTGAGGACGATCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25970
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047094 Nonsense 314 1263 9 25
Genomic Location (Zv9):
Chromosome 3 (position 2076596)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1543773
GRCz11 3 1318935
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACACGGCAAGAAGATCAACGGCACCTGGAACGGCATGGTGGGAGAGGTA[C/T]GAGAGTGTGTGTGTGTGTGTGATCTTCACTATCTGCTGCAGGCCTCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33073
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047094 Essential Splice Site 485 1263 14 25
Genomic Location (Zv9):
Chromosome 3 (position 2074295)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1541472
GRCz11 3 1316634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTGGAGATGGGCCATTCGTTTGTTTGCTCACTCTGTGTTTGGTCTTCA[G/A]TTTCAGAATCCCAATGATTTCTCTCCTCCGTTTCGCTTCGGGACGGTCCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25969
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047094 Nonsense 1036 1263 23 25
Genomic Location (Zv9):
Chromosome 3 (position 2071619)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1538796
GRCz11 3 1304658
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCATCCTGCACACGGGCAGCACAGCCTACGGTGGCGGCTGTGGGGCAT[C/A]AGGAGGGGTGGGCAGCAGCCGGCCTAGCTCTGCCACCTGCATGCGCTGTG
Associated Phenotype:
Not determined