Busch Lab

ZMP

DLC1

Ensembl ID:
ENSDARG00000079317
Description:
deleted in liver cancer 1 [Source:HGNC Symbol;Acc:2897]
Human Orthologue:
DLC1
Human Description:
deleted in liver cancer 1 [Source:HGNC Symbol;Acc:2897]
Mouse Orthologue:
Dlc1
Mouse Description:
deleted in liver cancer 1 Gene [Source:MGI Symbol;Acc:MGI:1354949]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa1141 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25547
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109970 Nonsense 976 1128 12 14
Genomic Location (Zv9):
Chromosome 1 (position 14021830)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14608616
GRCz11 1 15295129
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATGCCATTGTTTATTGGCAGGTTCAGGACGGCTCTTCTCTGCGGCAGT[G/A]GAAAGTTTGTGTGGATGTGCCTGCATCGGCTGAGGATGTCCTGCAACGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1141
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109970 Nonsense 1125 1128 14 14
Genomic Location (Zv9):
Chromosome 1 (position 14020244)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14607030
GRCz11 1 15293543
KASP Assay ID:
554-1052.1 (used for ordering genotyping assays)
KASP Sequence:
GGTCACCTATGTGCTGCGGAGGTGGTGCGGATACGAGACACTTTTACCTG[T/A]CTGGACAAATAAACACACACATCTATGTTGGCGTTTCATTTCATCTCTTA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461