Busch Lab

ZMP

and2

Ensembl ID:
ENSDARG00000079302
ZFIN ID:
ZDB-GENE-041105-2
Description:
actinodin2 [Source:RefSeq peptide;Acc:NP_001104660]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39857 Nonsense Mutation detected in F1 DNA Not yet available
sa6850 Nonsense Mutation detected in F1 DNA Not yet available
sa39856 Nonsense Mutation detected in F1 DNA Not yet available
sa19793 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39857
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114928 Nonsense 195 508 5 5
Genomic Location (Zv9):
Chromosome 2 (position 31481376)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31781313
GRCz11 2 31764531
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCTGTCACCTCTGCTCCCGCTGCCCCTGAAAGCACCTCTAGCCCATTA[T/G]TACTATGCTCCAGTCATGGAGCCATTTTTGTCAGCTGAGCAGAGAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6850
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114928 Nonsense 214 508 5 5
Genomic Location (Zv9):
Chromosome 2 (position 31481320)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31781257
GRCz11 2 31764475
KASP Assay ID:
554-4779.1 (used for ordering genotyping assays)
KASP Sequence:
TGCTCCAGTCATGGARCCATTTTTGTCAGCTGAGCAGAGAGCAGAGCTGT[T/A]GCGCATCTGCAACCCTTCAGACACAGAGTGTCTGCAATATCAYTTGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39856
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114928 Nonsense 230 508 5 5
Genomic Location (Zv9):
Chromosome 2 (position 31481273)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31781210
GRCz11 2 31764428
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTGCGCATCTGCAACCCTTCAGACACAGAGTGTCTGCAATATCACTTG[C/T]GAGCTGCTTACGGCTACAGACCCGCACTCGGCCCTCTGCCTTCTTACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19793
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114928 Nonsense 271 508 5 5
Genomic Location (Zv9):
Chromosome 2 (position 31481148)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31781085
GRCz11 2 31764303
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCCTTACTGTCAGCCCAAGCTTGTGGCAAGATCTCCCTCAGGTTTGTA[T/A]CACCTGTACCCTTCCTGTAATCCCGCCACTGACCCTCTTTGTGTTGCCAA
Associated Phenotype:
Not determined