Busch Lab

ZMP

cacna1bb

Ensembl ID:
ENSDARG00000079295
ZFIN ID:
ZDB-GENE-090514-4
Mouse Orthologue:
Cacna1b
Mouse Description:
calcium channel, voltage-dependent, N type, alpha 1B subunit Gene [Source:MGI Symbol;Acc:MGI:88296]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa3120 Nonsense F2 line generated Not yet available
sa3131 Essential Splice Site F2 line generated Not yet available
sa44962 Nonsense Mutation detected in F1 DNA Not yet available
sa37258 Splice Site Available for shipment Available now
sa32339 Nonsense Available for shipment Available now
sa29548 Nonsense Mutation detected in F1 DNA Not yet available
sa32338 Essential Splice Site Available for shipment Available now
sa43605 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa3120
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Nonsense 26 2333 1 52
ENSDART00000132142 Nonsense 26 1151 1 23
Genomic Location (Zv9):
Chromosome 21 (position 12832853)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14534027
GRCz11 21 14630756
KASP Assay ID:
554-2930.1 (used for ordering genotyping assays)
KASP Sequence:
CCACCCGCTATGGAGGTCCAGCGGGCGCCGGGAGAGGGGGAGCCCGGGCG[G/T]GAGGTCCCTCGGGCGGTCAAAGAATGTACAAACAGTCGATGGCTCAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3131
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Essential Splice Site 384 2333 8 52
ENSDART00000132142 Essential Splice Site 383 1151 8 23
Genomic Location (Zv9):
Chromosome 21 (position 12704643)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14405817
GRCz11 21 14502546
KASP Assay ID:
554-3323.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGATTGAGAGGGAGCTCACCGGCTACTTGGAATGGATCTGCAAAGCAG[G/A]TTAGTGTAAAAGTGACATTTCTCTGGTGTACAGTTAGAATCAGCTTTATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29550
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Nonsense 515 2333 12 52
ENSDART00000132142 Nonsense 496 1151 11 23

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12699587)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14400761
GRCz11 21 14497490
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGGTGAAGGCACAGAGTTTCTACTGGATCGTTTTGTGTTTGGTGGGAT[T/A]GAACACGATGTGTGTGGCTATTGTCCATTATGACCAGCCGGAGTGGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44962
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Nonsense 616 2333 15 52
ENSDART00000132142 Nonsense 597 1151 14 23

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12694344)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14395518
GRCz11 21 14492247
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTAATCCTAATTCTCTCTCTCTCTCTTCGTGTAGATACTGGAACTCTT[T/A]GCGGAATCTCGTGGTTTCTCTGTTAAACTCCATGAAGTCCATCATCAGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7952
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Essential Splice Site 998 2333 20 52
ENSDART00000132142 Essential Splice Site 1000 1151 20 23
Genomic Location (Zv9):
Chromosome 21 (position 12671041)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14372215
GRCz11 21 14468944
KASP Assay ID:
2261-5388.1 (used for ordering genotyping assays)
KASP Sequence:
CAGTCCACATTGGAYGGAGACGAATGTAGAGAGAATGGTGGTAAACGCAG[G/A]TAGGTTTTTATAGTGTACAGTGGCACCCAGAAAGTATTTKAATGCTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37258
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Splice Site None 2333 None 52
ENSDART00000132142 None None 1151 None 23

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12638323)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14339497
GRCz11 21 14436226
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGCCTTTCTGACCCTCTTCACTGTGTCTACAGGAGAGGGCTGGCCACT[G/T]TAAGTTCACTTCATCTATCACACACACACACACACACACACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32339
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Nonsense 1487 2333 32 52
ENSDART00000132142 None None 1151 None 23
Genomic Location (Zv9):
Chromosome 21 (position 12631375)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14332549
GRCz11 21 14429278
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCACTGTGTGTTTGTGCTTTCTGCAGTTCCATGGTGCTCCTAAACCTTA[T/A]GAGGACATGTTGAAGTGGCTGAACATCATCTTCACTGCACTCTTCACACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29549
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Nonsense 1579 2333 35 52
ENSDART00000132142 None None 1151 None 23
Genomic Location (Zv9):
Chromosome 21 (position 12620585)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14321759
GRCz11 21 14418488
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTCTCATTAAACTCCTTCGGCAAGGATACACCATTCGGATCCTTCTCTG[G/A]ACCTTTGTTCAGTCCTTTAAGGTCAAACCAATACCTTTGTTTCTATATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29548
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Nonsense 1720 2333 39 52
ENSDART00000132142 None None 1151 None 23
Genomic Location (Zv9):
Chromosome 21 (position 12615851)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14317025
GRCz11 21 14413754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAATATCTGACACGAGATGCTTCTATTCTGGGGCCTCATCACCTAGAT[G/T]AGTTCATCCGCGTCTGGGCTGAGTACGACCCTGCCGCCTGGTGCGTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32338
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Essential Splice Site 1837 2333 42 52
ENSDART00000132142 None None 1151 None 23
Genomic Location (Zv9):
Chromosome 21 (position 12603502)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14304676
GRCz11 21 14401405
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCAGTTTGTCATCTAAAACAGTAGACCTGCTGGTTACACCTCATAAACG[T/C]AAGCTGTGCATAACATAATGGCAGTTTCAGTTTAAAAAGCAATTAGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43605
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Nonsense 2127 2333 51 52
ENSDART00000132142 None None 1151 None 23
Genomic Location (Zv9):
Chromosome 21 (position 12585785)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14286959
GRCz11 21 14383688
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCAGAAAGGAAGCAGCGATACTACTCTTGTGACCGCTACGGCAGCCAT[G/T]AACATGGCCACAGCCTGTCCGCCGGGCCTAGCCGATCCACCTCTCCTGGA
Associated Phenotype:
Not determined