Busch Lab

ZMP

zgc:174877

Ensembl ID:
ENSDARG00000079278
ZFIN ID:
ZDB-GENE-041008-66
Description:
hypothetical protein LOC570025 [Source:RefSeq peptide;Acc:NP_001107091]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37821 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37821
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108994 Essential Splice Site 347 551 None 5
ENSDART00000130340 Essential Splice Site 347 552 None 6

The following transcripts of ENSDARG00000079278 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 6427834)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6315126
GRCz11 24 6344455
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGAGACTGAACGAACCGAGGGAGATCATGGCAGTTTGTTTACAAAGG[T/G]ACTGGTAATAATAGTGGCTTTGCTTGTAAACAGAGGACTTTGCACTGGGT
Long Flanking Sequence:
ACCCTGGGAACCCAAAGGGCTTGTTGTATAAGGTGTGGTATGACATCCAGTTGCATTTTGGGCTCAGGGGTAAGGAGGGCAACCGACACCTGCAGCCAGACACATTTGCTCTGAACCTGGACCAAAACGGATTTAAATACTTCACCATGGCACTACACGAGGAACCGAAGAACATGCCGGAGAAGGATAAGAAGAAGCGGAAGGCTATGTTTGAAGAGCCGGGGAATCCGCTGTGTCCTGTTGCGTCTCTGGAGAAATACCTGAGGAAAATCCCAGCCGACGCTAAAGCTCTCTATCTGCAGCCCAAAAGGAGCTATTTCCTCAGTGATGAGATCTGGTATACTGGACTCCCACTGGGAGTCAATCATTTGTCCCAAATGCTGCCCAAAATATGCAAAGAGGCAGGCACGAGAACGATATACACTAACCACAGTCTGAGGATAACAGCGATTCAGAGACTGAACGAACCGAGGGAGATCATGGCAGTTTGTTTACAAAGG[T/G]ACTGGTAATAATAGTGGCTTTGCTTGTAAACAGAGGACTTTGCACTGGGTTTGTAAAGCCAAATCATGTTAAACAACTCTTTTATTTCACATTCAAATGAATGATTCATCTAGAAAGGAAAACTGTCATCTTGCTTTTTATCTTGTATTTTGTGAAACACAATCCATATACGTTCTGAATGCCAAAAACTAGATTTGTTCAAGCAACAATCAAAATATTCTTCAAAATAGCTTTTTGCATTCCACATAATACAGTCATGCAGTAAACAATGACACAATTTTCATTTTGGAGACATTTATTACTTAGTTATAACTATATAAATAGGAAAGTTTGCTTAAATATGTATATTTTTCATTATTTAATTATCCTTAATTTATTCCATACCTGAACGGCTTACTTTCTTCTGTCAGGGTTCATACGGTCATGGAAAACCTGAAAAAATCATGGAATTTTGACATGGCATTTTCCAGGCCTGAAAAAGTTTTGGAAAAACTGAAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30036
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108994 Nonsense 549 551 5 5
ENSDART00000130340 Nonsense 550 552 5 6

The following transcripts of ENSDARG00000079278 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 6421456)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6308748
GRCz11 24 6338077
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAATAGATTTGAGCTGTATTTTAATCTCCTTCCAACAGGATACGTTCCC[C/T]AGTGTGACTAGGTCTTGATTCGCCTTCATCAAGAAAAAGAAGAAGAGCAT
Long Flanking Sequence:
AATTATTTATTTTTAAATAATTATTCCACCATCCACTTACGATGATAATGCCATCGTCCATCGCAATGTTTTACATTGGACACATCGTACGATGCCGAATTGGTCAACATTGCTCAAACCTACTTGAAATATGGTTTGAGTGTTTAATGTACTTACAAGCATTTAAGGTAAACAAAATTACATACGTTATGTTAATTTGAAGCATGACAAAAAAATTAAACCATTTAAAATGTATTTTACGTGTCTCTTTTTGAGATTATTATATGCAAGAAGAATCGTAAAAGTGTGATGTTTTAATTATATTTATGTTTTCTGAGTTCTCTCACAATGTAAATAACTACACATTTAATACAATTATCAGTCTTTTTCACAAGGGATTCATTTGCGGAAGATGCTTTTTTAACAATAACCACATGCAAAATTGAACGTTTAAAAACAAAGGTCTAAATTCTAATAGATTTGAGCTGTATTTTAATCTCCTTCCAACAGGATACGTTCCC[C/T]AGTGTGACTAGGTCTTGATTCGCCTTCATCAAGAAAAAGAAGAAGAGCATGAGTAGGGTTTCCTGCTATAAGGTTAACAGGGCCCAGGACAGTTTTTACAAGCAGACCTCCATGTGCCAATAAGTACAGTAGGCTGCACTGTGAAAGAGTTTTTTGGGTCATCCAGTGCTTCTGTTTGACCCTCACTGCCTGTGTCCCGAACATGTATCAGGGTCTGATCAGGCCTTGTGAGGAAACACATGTCAAGCAGTGTGTTCCGTCTGTTGAGCTGTTCAGATGATCAATATTTACAGTCCGGAAAAGATTCAATCATTCTGAGCCTCATTCTAGGGGATTTACAGTATGAGTTCATGTGAGTCAGATCATTTTTTGTTTAAATACTCAAGTTATTAAGTTATAACCGTTTATCAAATGTAACTTTACAGGGGTTGGACAATAAAACTGAATCCGCCTGGTTGTAGACCACAGTAATTCATTAGTATGGTGTAGATCCTCCTTTT
Associated Phenotype:
Not determined