Busch Lab

ZMP

foxe1

Ensembl ID:
ENSDARG00000079266
ZFIN ID:
ZDB-GENE-061116-1
Human Orthologues:
FOXE1, FOXE3
Human Descriptions:
forkhead box E1 (thyroid transcription factor 2) [Source:HGNC Symbol;Acc:3806]
forkhead box E3 [Source:HGNC Symbol;Acc:3808]
Mouse Orthologues:
Foxe1, Foxe3
Mouse Descriptions:
forkhead box E1 Gene [Source:MGI Symbol;Acc:MGI:1353500]
forkhead box E3 Gene [Source:MGI Symbol;Acc:MGI:1353569]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa39620 Nonsense Mutation detected in F1 DNA Not yet available
sa32687 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39620
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109297 Nonsense 33 354 1 1
Genomic Location (Zv9):
Chromosome 1 (position 25668903)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26009120
GRCz11 1 26702834
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCAGTGAATGACAGTCAGAGAGCAGAGCCGCAAAGAGGCCGTCGGAGG[A/T]AGAGGCCCCTTCAGCGAGGCAAACCACCATACAGCTACATCGCTCTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32687
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109297 Nonsense 84 354 1 1
Genomic Location (Zv9):
Chromosome 1 (position 25668749)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26008966
GRCz11 1 26702680
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGTTTATCACCGAGAGGTTTCCCTTCTATCGAGACAACTCCAAGAAAT[G/A]GCAGAACTCCATCCGCCATAATTTGACACTCAACGACTGCTTTATCAAGA
Associated Phenotype:
Not determined