Busch Lab

ZMP

zgc:175133

Ensembl ID:
ENSDARG00000079252
ZFIN ID:
ZDB-GENE-080515-7
Description:
hypothetical protein LOC100151756 [Source:RefSeq peptide;Acc:NP_001120943]
Human Orthologue:
FAM117A
Human Description:
family with sequence similarity 117, member A [Source:HGNC Symbol;Acc:24179]
Mouse Orthologue:
Fam117a
Mouse Description:
family with sequence similarity 117, memberA Gene [Source:MGI Symbol;Acc:MGI:2144564]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22042 Nonsense Available for shipment Available now
sa44751 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3817
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110458 Nonsense 11 339 1 8
Genomic Location (Zv9):
Chromosome 12 (position 10824489)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9811911
GRCz11 12 9849754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAACCAGTGTTTGCCGAGTGATGAAGATGTCTAGAAGCGGATCAGGTCTC[C/T]AGCCTCTCAAAGCTACTGTTCCCTTCACACTGCACAAAGCAACTGGAGCT
Long Flanking Sequence:
GCGGATGATGAGTAGATGAATACCAAATGTTAAATTTATGAGTGAAATATATCTTTAAATAAATTATGTCGTCTTATTACAGGATTGATGTCGCATTATCCAATACGCGTATTGCTGGCATTTCTTTTAGCCAATCAAAAGGCGAGTAGTAAACGTATCCTCCCACTTCCCAAAATGAATGAAAGATGCGACAAAGCGTCCTCAGCGTTACTCCACTTTCAGCAGCAGAGTAACTCGCTTAACTTTATACTTGAGCACTACTTGAATTTGTTAACGTTCTAGGTCTGGTTAAGAACTAGATAAGAAACATCTAAAACAACTGGTAATAGACAGTTGAAGAAGGACAAACTACAACAGGACGTAGATAACAAACTGAATTTTGCACGCGTCGTCTTTTACGTACGTTGCGCAGGTTTGTTATGTTTTCTACAGAGACAGAAAGAAGCGTGTGAACCAGTGTTTGCCGAGTGATGAAGATGTCTAGAAGCGGATCAGGTCTC[C/T]AGCCTCTCAAAGCTACTGTTCCCTTCACACTGCACAAAGCAACTGGAGCTGCAATCACAAACATTACACCAGGTGAAGTATTTAACGCACACCACCATCTACTAATGTACCACACAAGAGCTACACCACTGAAAGTCCTGCCTCAATATATACATTATGAATAGCTTCAGTTCGAAACTGTACTTTACTATCTTTTCAAATAGGCTTTAAACTTTCTAAACGCGTACATTAATTAACTTACTTGTATTTTAAAGTTTGGGTTTTGCAACTATGGTGGTTCCTCATTGGGAAATATAAAATTTAACAGTAAACTCATTTAATTAGTACTTAGACAATACAGTTTTGTCTCGACTGCTGCTGCATCATCAATTGGGGTAAAGTTGGTTTCATATTCACACATTCTGACTTTCTCCATAATAATATATTTTCAGAAAAGGCATTATTTGCATTTTTTAAATGGGGAAATTATATTAGCAGCCAATGACTATGAAAGAACAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22042
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110458 Nonsense 128 339 4 8
Genomic Location (Zv9):
Chromosome 12 (position 10838114)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9825536
GRCz11 12 9863379
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTATGTAAAATGTTCTGTTTTTGTTTCCAAGTTATCCAAGCAGAAACAA[C/T]AACTGCAACAGAAGCAACGGTCAGGAGTTCCAGTTGGCAGCAAAGAGAAA
Long Flanking Sequence:
TGTATTGCAAAATCGACATTCAACTGATTAATTCCACAGTCATGCAATAGCTTTATATGAAAAGCAGATGGCAAAATAAGTAATTCTTGTCATGCTGTAGTTCACAATTTCTTTTTGCTGCACAAATTCAGACCTGTTGCAACATGCTTTGAATAAATTATGACTGAATCAATAAACATGAAGTATCACTTTATTAAATTGTTTAGCCAAGTTTTTTTAAAATTTTTTTTTATGCTGTCTGAAGTGATGCTGATGGTTGGTATTTTTGTAAAAGACACCACGAGCGTGGCTTGCTGGAGTAGAAACAACGACTATTAGATTGCACAGACGCTCTGCATCGTGGGGGAATCCAGAACGTCTCCAGGATGGAAGTGATGCGTGTCCAGGTTCATCAGTAAGTCAAAGATAGGACGCTACTTAATTTACAGTTACTTGTGTAAGGTTTAACTTAGTATGTAAAATGTTCTGTTTTTGTTTCCAAGTTATCCAAGCAGAAACAA[C/T]AACTGCAACAGAAGCAACGGTCAGGAGTTCCAGTTGGCAGCAAAGAGAAACTGCACAACCAACATCAGGTACACGTACAATCACCCACATGCACACATGCATGCACACACGCACCATTATTCTCTCATTCTTGCTGTTCTACGCTCCTTAGTTCCTCATTTTCAATCCTTATTTCCCTTTTCAAACTCTACATAAGATCATGCAGTGCTATTTAAGAGCTGACTGAAAAAGCATAGGATATTTGTGCTAATAAGTCCAAATAATGTCTGGTGAAAACAGCAAAATTATTACTATTTGCTAAGCACATTTAGTGCTATTTGTAAATGCTGCATATTTGCACCTAAGTGCATTGTAGTACATTTATGAGACAGTGTGGAATAATAACAGAATTTTTAGATGCTGTATTTTATATGGTTTTAAATATTGTAGATGCTTTTTGCATAGTACATTATACAACAGTATTCAATTTTAACAGCTATAACAACATTATTCAATGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44751
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110458 Nonsense 288 339 8 8
Genomic Location (Zv9):
Chromosome 12 (position 10849767)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9837189
GRCz11 12 9875032
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTCTCCCTTTTTTTCCAATTCAGCCCTTCATGTTTGGAGCAAGTGTG[C/A]ATGTCTTCCTGCCCCGACCCCAACAAAGTGAACTTCACCACACACACGGG
Long Flanking Sequence:
ATACAAGAAGTCTGAGAATAAATGGTCGTGCCCATCTGAGCCTTGTTTCTCTCAAGGTTTTTTCTCCCTCACTTTTGTCAATTGGTGAAGTTTTGTTCCTCGCTTGTGGAGCTGCGCATCGATGGATTTGCTCCTCAGTCTTTGGACTTTAAGCAATGAAAATTAATCCACACTGAACTGCACTAAACTGAACTTCAACTTCTACGTTAAGCTGCTTTGACACAATCTACATTGTAAAAGCACTATGGAAATAAAAATGAATTTAATGAAATTACGTTGAGAATAAAAAAGGTTGAATTCTATTGAGCTTTTGAACTCAATGGCCAATTGGCAATTGGCAAAATGCTCGAATGTTAGCGGGAAATGGACATTTAAAAAGTATTTGTACCAGTTAGTGCCAACACTATACTGGGGTCTTAATTCCCATCGTTCCACCTTACGTCTTTAGTCATTTTCTCCCTTTTTTTCCAATTCAGCCCTTCATGTTTGGAGCAAGTGTG[C/A]ATGTCTTCCTGCCCCGACCCCAACAAAGTGAACTTCACCACACACACGGGCTCCGCCTTCTGCCCTGTCAGTCTCCCAAAGCCCCTCCTCCCTCCAGTGGACTTTCTGATCTGCAGCCTTTCAGTTTCTCCAGGCTCCTGCTGGGTTGGACAGTGAACACTTCCTAAGAAACCTGTTTGTAAGAGGTGAAATGGCTGTATCTTTAAAAAGCACTGCTTGTTGCATTTGCTTCAGCATCTGACCTTGATTTAAAAAAAAAAAAAAAGGACATTTTTCATCGTTGGTCAGTGAAAACCTTACACATTTGTTTTCTAGTTTAAAAAAAGTATTAGTGATAAGAGAGAGTACTGGCTTTCTTTATATGGGTCACAGTGTGAGTGGTGAAGATGGCTTATGGTTAAACAATTTAGGCAGTTATTTTCTTAAGGAAATAGCAGTTCTTAGACAATGAATGTTACATTTTTGCTATATAAAGATGAATGGTACTGTAAATGCAATGT
Associated Phenotype:
Not determined