Busch Lab

ZMP

zgc:172140

Ensembl ID:
ENSDARG00000079227
ZFIN ID:
ZDB-GENE-080204-50
Description:
hypothetical protein LOC100136845 [Source:RefSeq peptide;Acc:NP_001108036]
Human Orthologue:
C10orf81
Human Description:
chromosome 10 open reading frame 81 [Source:HGNC Symbol;Acc:26285]
Mouse Orthologue:
9930023K05Rik
Mouse Description:
RIKEN cDNA 9930023K05 gene Gene [Source:MGI Symbol;Acc:MGI:2443041]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa17287 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7702
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109808 Nonsense 208 331 9 13
ENSDART00000128525 Nonsense 227 380 8 13
Genomic Location (Zv9):
Chromosome 12 (position 32093131)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30405794
GRCz11 12 30520696
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGTGAGTGAAAARGAAGAAAGCCTTGATGAGACCNNNGAGGAAAGCAAT[G/T]AGGAGCTGTCRTCMGAGTAASACAAACTCTTATTCTGGATTTAAAATGTA
Long Flanking Sequence:
ACCATTTAATTGGTTTTATTCAAACTAAAAAGTCTTTTTTTTTTATGTGTTCACAGAATTTCAAAATTGAATCACAAACCAAACCACAAACCATGACAGAATCCACTGACAAAAACCCTTGTGACAGCGACAAGGTAAATTAATCCTCAATGTTTCTCTCTTATGCTTATTGTGACTTAAACTGACTTCCCAGCTGAAATATTTCTTCCCGTACCTCTCGCTGTAGAGTAAAGCCGTCAGTCGACCCGCAGTGCCTCCAAGGACGAGGTCTTTTGAAGTTGTTACCAGCCATCCTGAAGAGTGCTGCCAGCAAACACACAATAGAAACCGATCTGAAACAAAGGTATTGCATTGTTGTAATTTTAACACTGCCACTAAAACCAAACACTTGCATCGTTATACATTATTAAATTAAAATATTTCATGCTGATACAACTGCTTGACTTATTCAGGTGAGTGAAAAAGAAGAAAGCCTTGATGAGACCGGAGAGGAAAGCAAT[G/T]AGGAGCTGTCGTCAGAGTAAGACAAACTCTTATTCTGGATTTAAAATGTACATTACTTTATCGTTAAAATGTTAAATAAACCATTCTATTTGTAACTACCGTAATTGTCCTTGAAAAAGTGGTGCGATAGAATCATTCGTCTGATTAGCAGCTTTTAGCAAATTTAAGCTGTTTGCAATTATTAATAATTACACTGTACACTAAAAAAGTGATTTGTTACTAAAAGCGAGTAAACCAGTTGCCTTTAAAGAAACAAATTGACTTTACAAAAATAATGTAAGTAAACCTAGTTCCTTGGAACTTTTAAGTTGACTTGTTTTTTGCAATTATGCAAATTGTATTCACTTTTTTTTTTAATGAAAGTAAACTAATCACTTTTTTTCAATACACATTTACAATTACTATACTTGCTTTTTTCAGCTTTTCTGTATCTAGCAAAATGACAGTAACAAAAATAAATCTGCTCTTCCAGACTCCAGTGTGTCTTCTAAATTCAATAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3822
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109808 Essential Splice Site 251 331 10 13
ENSDART00000128525 Essential Splice Site 270 380 9 13
Genomic Location (Zv9):
Chromosome 12 (position 32094337)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30404588
GRCz11 12 30519490
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAAAGACACAGGAAAAAATCACCGAGCCACACAGTCAAACACCACAAAG[G/A]TAAAAACAATTAAGYATAAACAGAATATTTCTAATGTAAAGCTTCCAGTT
Long Flanking Sequence:
ACAATTGGTTTACTCGTTTTGATTAACTAATCACTTTTTACAGTGTAAAAAATGCTGGGTACAATCGATTTGTGTTGGGACAACATGAATGAAGTTATTTGTTTTTAAAAAATGTAAATTTGTTGTAAAAAAGTTGTCGCAAAAAATCCTAAATAATTCTTTTGCAGATCATTTTAATTTAGTAATTTGAACCAACAACAAACATAACTTCCTTAGTGTATGAAAGCTTGTTTGTAGTAGTCAAGTGTCATTTTGCAGTTTTAAAATGTATGCTGTTTCTCCATGATTTTGCTGACTGACTTGTTTTCTAGACTCATGCTTTGTACAGAAATGTCAGTGATATAAATAATCAGTTTACTTAACAAGTATTTGCCTTTTTCCTAAAGGGAGAGTGGGATTGGTTCATCTGAAGACAGTCTGTTGACCTGTATGACGCAAGTCTTCAATAATTTAAAGACACAGGAAAAAATCACCGAGCCACACAGTCAAACACCACAAAG[G/A]TAAAAACAATTAAGCATAAACAGAATATTTCTAATGTAAAGCTTCCAGTTGTATGAAGTAACCAATTATTGCTTATTTTCTTATTATTACTTATAATCTTTTGCATTTTTTTTTTCTTTCAGTACCACCATCAGCGACATTAACAATACAGACTATTGTACTAACTTCAATGGAAACAGGTGATTTATGCTTTATCTGTATTTCAAAAACATTTCTATATTCTTTAGAGAGCGGTTTAGTTGAAAACACCTGTCAGAAACCCCATCCCCCCCTTAACCTGCAGAATTCAGTTGTCAATCAGCTTTGATTATGAAATTGTGGTTTTGGAATCCAACCACATTTTTACACTGCGTTCCATTCCCCAGTAAAACATACACCTTTGTTGAGAAGGAAATCAGCTTAAGTGCATGTGAACTGAAAAACCTGGTCTTTTCAGAGGAGACAGGAAGACTACGGTAAAACTATAACAAATTGATTTTAAAGTTATTCATAATAAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17287
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109808 Essential Splice Site 313 331 12 13
ENSDART00000128525 Essential Splice Site 362 380 12 13
Genomic Location (Zv9):
Chromosome 12 (position 32096000)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30402925
GRCz11 12 30517827
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACACAGTGGAGGACATACAGCTATACATAAGAAAACTTTCCAAGGGCGAG[G/A]TAATCATGAGTAGATCAATTCTTTCCACTGTRTGATCACAGCTACAGCGT
Long Flanking Sequence:
AAAAATTCCACTATTTTTTTTTTACAAAAAAAATTATTAGAATAAAAAATTTTCATATCTTTATGATTAAAAATCTTTTTTTTTTCTCCAAATAATGATTTACTCTTTTCAAGTTTTTTTGGTTATATTTTTACATTTCATAAAACATGTAACATAAAAATGAACAGCTTAATTTTACATTTAGAGAAATGCCATCTTTTCACAGAATACAACAAAAAATAAGTTTTATCTTTCTCAGATGTATAAACTGTAAATTCAATGCCATCTTAATTTTTTGACATATCATTTTTGACAATCCTGGCTGATGAACACAGAAACTACAAATACTACCACTTACGTTTGTTATTTTTCCATTTCATTTCTTCTACAGCATGAAAGGTAAAAAGCGCGAGGTGTCATGCTCACTTCATGAGGGAGATGAGATCCTAGCATTCAATGACCTGTTGACATACACAGTGGAGGACATACAGCTATACATAAGAAAACTTTCCAAGGGCGAG[G/A]TAATCATGAGTAGATCAATTCTTTCCACTGTGTGATCACAGCTACAGCGTGATACTGACATTTTTTGTTTCCCCTCTTAGGTAACATTTACAGTTCGACGGCTCAAAGACTCCATTCCTATGTGTTCTGAAAGTTAAAGACAGACAAAAACAAAACAAAACAGCCTAATCTCATACGACTTTACTTGTTGAGCTGCTTTGCTAGTCCCTTCACTTTTATTAAAATCAGTAATTGTTTCTTTTTGTTTTTTCAGTCCAGTGAGTAAGCTGATAATACTTATTAATGTAGCAAAACTGCTAGTTTTTCTAGTGGTGATTTTTGTAAATGAATTATTGGTGACAAATTGTACAGGGTGTCAACAATAACACATTAAGCTTCTGTCTTCTGTCTACAATAAGTCTTGTTGAGCTTTGAAATCAAATATAAAAAAATGTCTTGTTTTATTGTGCTTGTTTCAAATTACTGAGGTTAATGGGGCAACAGACTTGCATGCATTAACA
Associated Phenotype:
Not determined