Busch Lab

ZMP

ENSDARG00000079226

Ensembl ID:
ENSDARG00000079226
Human Orthologue:
PCDH15
Human Description:
protocadherin-related 15 [Source:HGNC Symbol;Acc:14674]
Mouse Orthologue:
Pcdh15
Mouse Description:
protocadherin 15 Gene [Source:MGI Symbol;Acc:MGI:1891428]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa25681 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25680
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112787 Nonsense 611 1111 8 18
Genomic Location (Zv9):
Chromosome 1 (position 54112584)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52923075
GRCz11 1 53557089
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACAGATGTCAATGACAATGCTCCAGTCTTCAGCTCGGAGACTTACAGC[A/T]GAAGTATTCTGGTTAGAGACGCAAAGGTTGGAGAGTTGCTGCTGACAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25681
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112787 Nonsense 715 1111 10 18
Genomic Location (Zv9):
Chromosome 1 (position 54113173)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52923664
KASP Assay ID:
2259-1186.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAAAATTGCTTCTCTCTCTGAGAGTGTGTCTTTTGAGAGTTCCTCCTA[C/A]AACTTCATGATCAAGGAGAATGAACCCGAGGAGACAATAGTAGGCACGGT
Associated Phenotype:
Not determined