Busch Lab

ZMP

adam11

Ensembl ID:
ENSDARG00000079204
ZFIN ID:
ZDB-GENE-070808-3
Human Orthologue:
ADAM11
Human Description:
ADAM metallopeptidase domain 11 [Source:HGNC Symbol;Acc:189]
Mouse Orthologue:
Adam11
Mouse Description:
a disintegrin and metallopeptidase domain 11 Gene [Source:MGI Symbol;Acc:MGI:1098667]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa22056 Nonsense Available for shipment Available now
sa2649 Essential Splice Site F2 line generated Not yet available
sa5598 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa22056
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110503 Nonsense 91 774 3 27
Genomic Location (Zv9):
Chromosome 12 (position 14974096)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13829749
GRCz11 12 13868052
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCTCAGCCCATTCATCTTGCTCAAATCACATTCCTGGTAAAGGCCTTT[G/T]GAATACCATTTGTTTTGGACCTGGAGCTCAATCAGTATGTGCAAAATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2649
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110503 Essential Splice Site 334 774 11 27
ENSDART00000110503 Essential Splice Site 334 774 11 27
Genomic Location (Zv9):
Chromosome 12 (position 14944424)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13800077
GRCz11 12 13838380
KASP Assay ID:
554-3154.1 (used for ordering genotyping assays)
KASP Sequence:
ACAGGAAGGAGAATATYAAAGAGAAGAGTGACACAGCTCACCTSCTCTCG[T/C]ATGTTACACTTCCCTCTAGTTCTGAACTGGACTAGTCTAGGWTTKAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5598
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110503 Essential Splice Site 334 774 11 27
ENSDART00000110503 Essential Splice Site 334 774 11 27
Genomic Location (Zv9):
Chromosome 12 (position 14944424)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13800077
GRCz11 12 13838380
KASP Assay ID:
554-3154.1 (used for ordering genotyping assays)
KASP Sequence:
ACAGGAAGGAGAATATYAAAGAGAAGAGTGACACAGCTCACCTSCTCTCG[T/C]ATGTTACACTTCCCTCTAGTTCTGAACTGGACTAGTCTAGGWTTKAACTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27918
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110503 Nonsense 353 774 12 27
Genomic Location (Zv9):
Chromosome 12 (position 14942911)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13798564
GRCz11 12 13836867
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACATTCCAGAGCAGTCGCAGTGGCACTGCCTACATTGAGGGGATCTGCT[C/A]ACCAACAAGAGGAGGAGGAGTCAATGAGGTGAGATCTAAATGGAAACAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27917
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110503 Nonsense 497 774 17 27
Genomic Location (Zv9):
Chromosome 12 (position 14933537)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13789190
GRCz11 12 13827493
KASP Assay ID:
2260-5125.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTTAACTCATGATGCAATGTGTAGCAATGGATTGTGTTGTAACCGTTG[C/A]AAGGTAAGTAATGTTACAATTATTTACATTGAAATTTTCATCTGTATTTT
Associated Phenotype:
Not determined