Busch Lab

ZMP

ryr2a

Ensembl ID:
ENSDARG00000079171
ZFIN ID:
ZDB-GENE-071001-1
Description:
Ryanodine receptor 2a [Source:UniProtKB/TrEMBL;Acc:A7M794]
Human Orthologue:
RYR2
Human Description:
ryanodine receptor 2 (cardiac) [Source:HGNC Symbol;Acc:10484]
Mouse Orthologue:
Ryr2
Mouse Description:
ryanodine receptor 2, cardiac Gene [Source:MGI Symbol;Acc:MGI:99685]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa38909 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38909
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109255 Essential Splice Site 82 277 3 6
Genomic Location (Zv9):
Chromosome 12 (position 48448393)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47328426
GRCz11 12 47326284
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCAATGTAGCCAAACAAGTCTTCAACACTCTTACAGAGTACATTCAGG[T/C]ACAGTGCACTTATTTAAACCTGTTATGCCAAAATCACTTTAATAAGGGGT
Associated Phenotype:
Not determined