Busch Lab

ZMP

wu:fb81h03

Ensembl ID:
ENSDARG00000079166
ZFIN ID:
ZDB-GENE-030131-1826
Human Orthologue:
ACE
Human Description:
angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 [Source:HGNC Symbol;Acc:2707]
Mouse Orthologue:
Ace
Mouse Description:
angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 Gene [Source:MGI Symbol;Acc:MGI:87874]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa12049 Essential Splice Site Available for shipment Available now
sa19024 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17717 Essential Splice Site Available for shipment Available now
sa41956 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9141 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12049
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114637 Essential Splice Site 310 1324 5 25
ENSDART00000114637 Essential Splice Site 310 1324 5 25
Genomic Location (Zv9):
Chromosome 12 (position 6234847)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5516478
GRCz11 12 5551435
KASP Assay ID:
2261-7169.1 (used for ordering genotyping assays)
KASP Sequence:
TGGTCCRAAATACATCAACCTTAAAGGTCCCATCCCTGCTCATCTATTGG[G/A]TAAGTCTTTTAATATTRTGAAAATATTATGCATATTSTTCRTGTTATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19024
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114637 Essential Splice Site 310 1324 5 25
ENSDART00000114637 Essential Splice Site 310 1324 5 25
Genomic Location (Zv9):
Chromosome 12 (position 6234847)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5516478
GRCz11 12 5551435
KASP Assay ID:
2261-7169.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTCCGAAATACATCAACCTTAAAGGTCCCATCCCTGCTCATCTATTGG[G/A]TAAGTCTTTTAATATTGTGAAAATATTATGCATATTGTTCGTGTTATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17717
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114637 Essential Splice Site 524 1324 9 25
Genomic Location (Zv9):
Chromosome 12 (position 6231981)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5519344
GRCz11 12 5554301
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGGAGAGACACCGCCTGMCCGCTACAATGCAGATTGGTGGTACCTCAGG[T/A]AAAAAAATAAACATATACAGTTGAAGTCAGAATTATTAGCCCTCCTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41956
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114637 Essential Splice Site 668 1324 12 25
Genomic Location (Zv9):
Chromosome 12 (position 6228160)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5523165
GRCz11 12 5558122
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATTTTAACTGGGTGCCACCAATACCAGAGGGCTACCCTGAAGACATTG[G/A]TAGGAACTTGAGTGAATGCTATTTTTATTAGGGTTCAACAAAACTGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9141
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114637 Essential Splice Site 999 1324 19 25
Genomic Location (Zv9):
Chromosome 12 (position 6217432)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5533893
GRCz11 12 5568850
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGGTGTGCCATGCCTCTGCCTGGGACTTCTACAACCGCAAAGACTTTAG[G/A]TRTSRCAATCGTATCACTTTAAACTCCCTGTTATACAACAACACACTGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27874
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114637 Essential Splice Site 1122 1324 22 25
Genomic Location (Zv9):
Chromosome 12 (position 6212629)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5538696
GRCz11 12 5573653
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACATGTAAATGGTGCAATCTGAAATATCTCCTGAATGTTTTAATTGTT[A/T]GAATGAAGTATCAGGGATTGTGTCCACCCGTCCCGCGCACTGAGAAAGAC
Associated Phenotype:
Not determined