Busch Lab

ZMP

C12orf51 (1 of 3)

Ensembl ID:
ENSDARG00000079151
Description:
chromosome 12 open reading frame 51 [Source:HGNC Symbol;Acc:26611]
Human Orthologue:
C12orf51
Human Description:
chromosome 12 open reading frame 51 [Source:HGNC Symbol;Acc:26611]
Mouse Orthologue:
Gm15800
Mouse Description:
predicted gene 15800 Gene [Source:MGI Symbol;Acc:MGI:3647820]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa14065 Essential Splice Site Available for shipment Available now
sa41086 Nonsense Mutation detected in F1 DNA Not yet available
sa7110 Nonsense Mutation detected in F1 DNA Not yet available
sa38657 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21151 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14065
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108874 Essential Splice Site 450 1044 10 20
Genomic Location (Zv9):
Chromosome 7 (position 74651776)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72238270
GRCz11 7 72501484
KASP Assay ID:
554-7922.1 (used for ordering genotyping assays)
KASP Sequence:
TTRAAGCACWTTTTTTGGTTTATATGCAGTTGGTTTGTTTTGTGACTCAC[A/G]GAATAAAATGAAGGAGCTGGAGCTTCTCTGTTCGCTRAAGGAGGTTCCTC
Long Flanking Sequence:
GACTTTAGCTTTTAAAAAGACACGCCAGAATAAGTATATTTCTGTAAAGCACGGCAAAATAGGATTGAAACCATTATTTAAAATGCAACACATTAAGTAATGTCGTAAAGTAAAGTAAAAATTTGGTTGATAATAAAATATTTGCTAGTAGGACTCAACACTTGTGAGCACTCACTCCAATGGGTTTGCGCAGCTCTCAGTCCCGCCCACACTCGTCAGCCCTACCAAGCTGACCAATCACAAAGCTTGCGCTACGCGTCATTGCGACATGTAGTTGCATTTTTTGAGAGGTGCGCGTCAGCATCAGCGATGGCCAGGGCGAGGACTACGCAGAGGCTGTGCCTGACCATACGCGCACGCTTGATGCAGAAGTATAAATCAGCCTCAACTTAGGCACAAACTGTAAAGGCTCCGCCCTCTTCTTGAAAAGGGGTGGGGCCAGCTGCTCCTTTGAAGCACTTTTTTTGGTTTATATGCAGTTGGTTTGTTTTGTGACTCAC[A/G]GAATAAAATGAAGGAGCTGGAGCTTCTCTGTTCGCTAAAGGAGGTTCCTCTGGACTGCACTGATCCAGAAAACGCTGTGATGGCTTTGAGGTTTGAAATGCAAATGATACAAATTGAATAATTAGAATAAATCAGTTTGGGGTCAAAGAGATTAATATAATATGAAAAAAGATTTTTTTTTTTCACTCATATTTTCCAGATTACTGAACTTTTGAATATTAGTGTTTGTGTTATTGCCGTTTGAATTAATAGTAATGTGTTTTCTTATTTTTTCAGAGAGAAGTTTTTTCATGAGGTGAACTCCACGCTGCAGCAGCAGAGAAGTGTTGTTCCTCTGGCTAAAACCAAAGCGCTTGTGAAGAGTTTGATCAACCGCTCGGAGCTGCTGCTTCATGTCACCATCGCTCCGCAGTGCAAGAGTCTGTCATCAACACCCACAAGCACACCGGGTAACACACACACACACACACACACACACACACACACACACACACACAGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27105
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108874 Nonsense 709 1044 15 20
Genomic Location (Zv9):
Chromosome 7 (position 74645508)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72232002
GRCz11 7 72507752
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGGGATGATGGAGCAGGTGCAGGAGGCGTTTGGAGAGACCATGACGT[C/A]AGTGGTGTCTCTGTGTGCCCGATACCCCATCGCCTGTGCCAACAGCATCG
Long Flanking Sequence:
TGGAGAAGAGGACGAACACGCAAACAGGCTCTGGTTCACATGCGGGAGCTGCTGACCGCTGCCGTCCGCGTCGGTGGAGTCACTCATCTGGTCGGACCCGTCACTATGGTCCTGCAGGGGGGACCCAGGTACTCTTACACCACCACAACATCACAAATCAGCATTCACTATAGGGCTCACTGTGAGGAAATGCATGCTTTTATTTGAATACAGCGCATCTAAAGTGACCCGTCTAAAGGCATGTCTAATTTCTGTTTCACATAGGTCAAATCTTTTATGATATTACTGTATTTTTTTATTAAATAAATGCAATCTAAGTGTAACTTAGAAAAACACTCATAGTCTAATCATGTGTGTGATATTTTAATGCAATACAGCTAGACTGGCAGATGCTCATATTGTCGATGCGTGCGTGTGTGTGTGTGTTTGAAGGGTGGAGGAGCTCACCTGTGGTGGGATGATGGAGCAGGTGCAGGAGGCGTTTGGAGAGACCATGACGT[C/A]AGTGGTGTCTCTGTGTGCCCGATACCCCATCGCCTGTGCCAACAGCATCGGCCTGCTCTGCACCATCCCCTACACCAGGCAAGCACAATGATGCAACACGGGAGAATTCATGAACGGGAGGGAAGAGACATAGCTGACACTGGTGCAGTGGGTCACATGATAATGACTAGTGGAAGATGGAGAACATCCCAATTCCATTCACACTACTCGCATTCATGCTATATAGCACAGGTGTCAAACTCAGTTCCAAAAGGGCCGCAGCTCTGCACAGTTTAGTTCCAACCCTAATTAAACACACCTGATCAAACTAATTGAGTCCTTCAGGCTTGTTTGAAACCTACAGGTAAGTGTGTTGGAGCAGGGCTGGAACTAAACTGTGCAGGGCTTCGGCCCTCCAGGAATTGAGTTTGACACCCCTGCTATATAGAACCTTCATTTCTAGCAATCGTGTAGTTAGTTGAGATCCATATGTGATACATACTTGAGTGGTAGGCCATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41086
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108874 Nonsense 716 1044 15 20
Genomic Location (Zv9):
Chromosome 7 (position 74645488)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72231982
GRCz11 7 72507772
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGGAGGCGTTTGGAGAGACCATGACGTCAGTGGTGTCTCTGTGTGCC[C/T]GATACCCCATCGCCTGTGCCAACAGCATCGGCCTGCTCTGCACCATCCCC
Long Flanking Sequence:
CAAACAGGCTCTGGTTCACATGCGGGAGCTGCTGACCGCTGCCGTCCGCGTCGGTGGAGTCACTCATCTGGTCGGACCCGTCACTATGGTCCTGCAGGGGGGACCCAGGTACTCTTACACCACCACAACATCACAAATCAGCATTCACTATAGGGCTCACTGTGAGGAAATGCATGCTTTTATTTGAATACAGCGCATCTAAAGTGACCCGTCTAAAGGCATGTCTAATTTCTGTTTCACATAGGTCAAATCTTTTATGATATTACTGTATTTTTTTATTAAATAAATGCAATCTAAGTGTAACTTAGAAAAACACTCATAGTCTAATCATGTGTGTGATATTTTAATGCAATACAGCTAGACTGGCAGATGCTCATATTGTCGATGCGTGCGTGTGTGTGTGTGTTTGAAGGGTGGAGGAGCTCACCTGTGGTGGGATGATGGAGCAGGTGCAGGAGGCGTTTGGAGAGACCATGACGTCAGTGGTGTCTCTGTGTGCC[C/T]GATACCCCATCGCCTGTGCCAACAGCATCGGCCTGCTCTGCACCATCCCCTACACCAGGCAAGCACAATGATGCAACACGGGAGAATTCATGAACGGGAGGGAAGAGACATAGCTGACACTGGTGCAGTGGGTCACATGATAATGACTAGTGGAAGATGGAGAACATCCCAATTCCATTCACACTACTCGCATTCATGCTATATAGCACAGGTGTCAAACTCAGTTCCAAAAGGGCCGCAGCTCTGCACAGTTTAGTTCCAACCCTAATTAAACACACCTGATCAAACTAATTGAGTCCTTCAGGCTTGTTTGAAACCTACAGGTAAGTGTGTTGGAGCAGGGCTGGAACTAAACTGTGCAGGGCTTCGGCCCTCCAGGAATTGAGTTTGACACCCCTGCTATATAGAACCTTCATTTCTAGCAATCGTGTAGTTAGTTGAGATCCATATGTGATACATACTTGAGTGGTAGGCCATTTGTTGATTCTCATGTGTTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7110
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108874 Nonsense 748 1044 16 20
Genomic Location (Zv9):
Chromosome 7 (position 74644943)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72231437
GRCz11 7 72508317
KASP Assay ID:
554-5052.1 (used for ordering genotyping assays)
KASP Sequence:
TTGTTCTCCGCAGGAGTGAGGAGCAGTGTCTGGTGCGCAGCGGTCTGGTT[C/T]AGCTCATGGATCGCCTCTGCAGTCTGAGCAGTCAGAGAGACTGCAGCTCC
Long Flanking Sequence:
ATCCCCTACACCAGGCAAGCACAATGATGCAACACGGGAGAATTCATGAACGGGAGGGAAGAGACATAGCTGACACTGGTGCAGTGGGTCACATGATAATGACTAGTGGAAGATGGAGAACATCCCAATTCCATTCACACTACTCGCATTCATGCTATATAGCACAGGTGTCAAACTCAGTTCCAAAAGGGCCGCAGCTCTGCACAGTTTAGTTCCAACCCTAATTAAACACACCTGATCAAACTAATTGAGTCCTTCAGGCTTGTTTGAAACCTACAGGTAAGTGTGTTGGAGCAGGGCTGGAACTAAACTGTGCAGGGCTTCGGCCCTCCAGGAATTGAGTTTGACACCCCTGCTATATAGAACCTTCATTTCTAGCAATCGTGTAGTTAGTTGAGATCCATATGTGATACATACTTGAGTGGTAGGCCATTTGTTGATTCTCATGTGTTGTTCTCCGCAGGAGTGAGGAGCAGTGTCTGGTGCGCAGCGGTCTGGTT[C/T]AGCTCATGGATCGCCTCTGCAGTCTGAGCAGTCAGAGAGACTGCAGCTCCAACGAGAAGCAAACCAAAAAGCAGAAAGTGGCCACCATGGCCTGGGCTGCGTTTCAGGTGCTGGCCAACCGCTGCATTGAGTGGGAGAAAGTCGAAGGTGAGGGACGGGAAGGCCATATGCTGAAATTTCAGCTCTCCGGTGAAACTTGTACTATTTTAAAAAAATTTCTCAAGTGGTGTTTAATAGTGGGAAGGTTTTTTTTACACATAATAGTGCCAATAATGATTTTCTAATTTCATTTATGTGTATTAAATGTCTTTCTCATGATGACAGTGTGTAATATTTTACTATAATTTTGCAAGATCAGTTTAAGGGGCAATTTAAATGCTTAACTAGGCAAGTTAGGAGAATTGGTCATTGGACAACAGTGGTTTGTTCTGTAGAAATGCTCCAAAAAAAATCCTAAGGGGGCTAATAATATTGACCGTAGCAGTTTTTATATTTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38657
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108874 Essential Splice Site 797 1044 16 20
Genomic Location (Zv9):
Chromosome 7 (position 74644794)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72231288
GRCz11 7 72508466
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGTTTCAGGTGCTGGCCAACCGCTGCATTGAGTGGGAGAAAGTCGAAGG[T/C]GAGGGACGGGAAGGCCATATGCTGAAATTTCAGCTCTCCGGTGAAACTTG
Long Flanking Sequence:
TCATGCTATATAGCACAGGTGTCAAACTCAGTTCCAAAAGGGCCGCAGCTCTGCACAGTTTAGTTCCAACCCTAATTAAACACACCTGATCAAACTAATTGAGTCCTTCAGGCTTGTTTGAAACCTACAGGTAAGTGTGTTGGAGCAGGGCTGGAACTAAACTGTGCAGGGCTTCGGCCCTCCAGGAATTGAGTTTGACACCCCTGCTATATAGAACCTTCATTTCTAGCAATCGTGTAGTTAGTTGAGATCCATATGTGATACATACTTGAGTGGTAGGCCATTTGTTGATTCTCATGTGTTGTTCTCCGCAGGAGTGAGGAGCAGTGTCTGGTGCGCAGCGGTCTGGTTCAGCTCATGGATCGCCTCTGCAGTCTGAGCAGTCAGAGAGACTGCAGCTCCAACGAGAAGCAAACCAAAAAGCAGAAAGTGGCCACCATGGCCTGGGCTGCGTTTCAGGTGCTGGCCAACCGCTGCATTGAGTGGGAGAAAGTCGAAGG[T/C]GAGGGACGGGAAGGCCATATGCTGAAATTTCAGCTCTCCGGTGAAACTTGTACTATTTTAAAAAAATTTCTCAAGTGGTGTTTAATAGTGGGAAGGTTTTTTTTACACATAATAGTGCCAATAATGATTTTCTAATTTCATTTATGTGTATTAAATGTCTTTCTCATGATGACAGTGTGTAATATTTTACTATAATTTTGCAAGATCAGTTTAAGGGGCAATTTAAATGCTTAACTAGGCAAGTTAGGAGAATTGGTCATTGGACAACAGTGGTTTGTTCTGTAGAAATGCTCCAAAAAAAATCCTAAGGGGGCTAATAATATTGACCGTAGCAGTTTTTATATTTTTTTAATCCAGCTAAACTAAAAGAAATAAAACTTCTTTTCCAGAAAAAAAAATAGAGTGAAATATATTGTGAAAAATGTCCTTGCTTTGTTAAACATTACTTGATAACTAGATTCTTAAAGTTTGAGCCTGATGGTAGATAGATAGATAGATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21151
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108874 Nonsense 996 1044 19 20
Genomic Location (Zv9):
Chromosome 7 (position 74640635)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72227129
GRCz11 7 72512625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGGACGGAAAACTCTCCATATTCATCCATAAGAGAGAAGACCAGTCGT[C/A]GCACGAGGTGCTGCAGCCTCTGCTCAGGTAAACACAGGCAATACGACCAC
Long Flanking Sequence:
AATATTAATAAATCGCCTGTGAATTAGAAAAATTCTCACAGGGGTTTTTGTTCACATATATTGTTCATATTCGTTTTGCATTTACTTGCTACTTATAAATAAACTTTATATACTTAAAAATGCGAACATATTAAATAATATGTGTTTATACAGTAGAATTGTTCAATATTAAGTGCCCCCAAGTCAATTCACATGCACTTTAATACTTCATAATGATGATTATTTATCGTACCTTTAATAATAGTGGATCAAATTGTGAACAGAATCATATCAATAACATGCTGTCTACTTAACATTTTTATTGACATGCTTTAATGTTGTATAATGTCCACTCTCAGGCTGTCAGACGTTGCTCTCTCCCAGCGCCTCTGAGCCGGACACCAGTCTGAGCCGAGCCTGTCCCAAGAGCAGCTCTAAGACCGACAGAGATGCCAGCGAGGAGGGCGAAGCGGTGGACGGAAAACTCTCCATATTCATCCATAAGAGAGAAGACCAGTCGT[C/A]GCACGAGGTGCTGCAGCCTCTGCTCAGGTAAACACAGGCAATACGACCACAGCCACATTTAGAGAGGACCTATTATGCCCCTTTATACAAGATGTAAACTAATTCTCTAAAGTCCCTAGTGTGTGTGTGTGTGAAGTTTCAGCTCAAAATACCACACAGATAATGGTAATAACTCTCTGAAACTGACCCTTTTAGGATTTGACCCTGATTGTGGCGTTTTGGTGACTGTCGCTTTAAATGCAAATGAGATTTTCAAAAGAGGGCGGAGCTACAAATGCCTCAGCATCGTGGCAAACTCAAAACCAAGACTAACATCTAATGCTAATGAGATGGTCTCTAGTGGGCGGGGCTTATTCAAGTGTGATTATAAAAAATTAAATTATAAAATAGAAGCTGTTCATATTCACACACTGTTTCTACACGGCTGTGTTTAAACCTGCATAATAGGTCCCATTTAGTGCTGTGTCTGAAGCTGCTATGGTTGATTTGTATTTTACGTC
Associated Phenotype:
Not determined