Busch Lab

ZMP

wu:fb77e12

Ensembl ID:
ENSDARG00000079148
ZFIN IDs:
ZDB-GENE-030131-1668, ZDB-GENE-090313-304
Human Orthologue:
NCKAP5L
Human Description:
NCK-associated protein 5-like [Source:HGNC Symbol;Acc:29321]
Mouse Orthologue:
Nckap5l
Mouse Description:
NCK-associated protein 5-like Gene [Source:MGI Symbol;Acc:MGI:3609653]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa31089 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43983 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24336 Nonsense Available for shipment Available now
sa30740 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31089
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109062 Essential Splice Site 25 1275 2 15
ENSDART00000110841 Essential Splice Site 11 1234 2 19
ENSDART00000134978 Essential Splice Site 41 1480 3 12
Genomic Location (Zv9):
Chromosome 23 (position 24939095)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24725215
GRCz11 23 24651756
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTACTTTTCTTCCTTGACTTGCTGTTTAAACTGGACTATTTTTGTAT[A/C]GGCAGAGAACTCTGCCCTTTCATTAGCAAACGAGAGTCAGAGAGAAGCAT
Long Flanking Sequence:
CAAGTTTTGTTATAGTCTCCCAATAGTTGGTTATATACATTATGTAGTAACTTGCTGTTTCAGGCTGTTTAAACACAAGGATCAGTGTTTTATGAGTTTTCACATTTGACTTATAGTTTTCTCTTTATGTTGGGACAGAATCATCTGTATTGAAGACAAGAACATTTGCCACTAATAATCAAAATAGTTTTATTTATAATATTTACCGCACTTTCCTTTCAGTATGGGGTGGGGGAACTATAAAAGAATGCCACACTAAAAATTCTAATCTCTTTGTTCTTGTTAGGTTGAGACAATGTCGGAAGAGGCTCAAAATAGAGTAGATGAGGACTTTGAGTCTGAGGAGGGTGATTTGGAGTCCTATCTAGAGGAAGAGAGTAGCAGTGAGCTTCTGGAGCGAGTGAGAGAACTTCAAGTAAGTGCCATATACTTTCACCAAGAATGCAGTTTTGTTTACTTTTCTTCCTTGACTTGCTGTTTAAACTGGACTATTTTTGTAT[A/C]GGCAGAGAACTCTGCCCTTTCATTAGCAAACGAGAGTCAGAGAGAAGCATATGAACGATGCTTGGATGAGGTGAGTTGAATGTTGTTCCTTACCAATCTATGCATTTGACTTTTTTAGATATCGGATCGTTTTTCCTAATGCAGACAGTCAATTAGTCAGATAAATAAATAAAATATCCCTGAAAGTACACAATGTTAACATCATGTCTTTGATGTAGGTGGCCAACCATGTTGTCCAGGCTTTACTCAATCAAAAGGTACAAAAATTGTGTTTTTTCTTCAGCAACATGTTTGTAAGGTTTATTTAAACGGCAAAGATAAAAGGTTCTTTTTTATTTAATATGTTTATTAATTTATTATTATTTGTTATAAATAATCGATAATGATGATTTTTTTTTAAATTTGTGGTTGTATATTTTATAACTGCCATGCATATTTTAGCCATATGTTTTTCAGATGATTTATTTAATATTATGAATTATTCTTTTAGGATCTCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43983
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109062 Essential Splice Site 61 1275 4 15
ENSDART00000110841 Essential Splice Site 47 1234 4 19
ENSDART00000134978 Essential Splice Site 77 1480 5 12
Genomic Location (Zv9):
Chromosome 23 (position 24939584)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24725704
GRCz11 23 24652245
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGCCATATGTTTTTCAGATGATTTATTTAATATTATGAATTATTCTTTT[A/G]GGATCTCAGAGAGGAATGCATCAAACTGAAAATGCGTGTTTTTGATTTGG
Long Flanking Sequence:
TATTTTTGTATAGGCAGAGAACTCTGCCCTTTCATTAGCAAACGAGAGTCAGAGAGAAGCATATGAACGATGCTTGGATGAGGTGAGTTGAATGTTGTTCCTTACCAATCTATGCATTTGACTTTTTTAGATATCGGATCGTTTTTCCTAATGCAGACAGTCAATTAGTCAGATAAATAAATAAAATATCCCTGAAAGTACACAATGTTAACATCATGTCTTTGATGTAGGTGGCCAACCATGTTGTCCAGGCTTTACTCAATCAAAAGGTACAAAAATTGTGTTTTTTCTTCAGCAACATGTTTGTAAGGTTTATTTAAACGGCAAAGATAAAAGGTTCTTTTTTATTTAATATGTTTATTAATTTATTATTATTTGTTATAAATAATCGATAATGATGATTTTTTTTTAAATTTGTGGTTGTATATTTTATAACTGCCATGCATATTTTAGCCATATGTTTTTCAGATGATTTATTTAATATTATGAATTATTCTTTT[A/G]GGATCTCAGAGAGGAATGCATCAAACTGAAAATGCGTGTTTTTGATTTGGAGAGGCAGAACAGAACACTGTGTGAGCTTCTGCAGGAGAAACTGCACAGTCAGTCTTGTGTACATCAGCAGGTAAATGATTAAAACTTGCAATGGAAAATGCACAGTGCATGCCTTCTAAGTTGATGTTTTTCACAAAACATTCTTCAAACTCCACTGGGATGACCTATTAGGTTTGTTTGCAAATTGGAGAAAATGGCTCAATTAACGTCTTCCTGTTTAATTTCCCTGTGCTCCTCAGGCAGCATTTTTTTTCCCTGTAATTACAAGAAATTTGTTTGTAAATGGGCAAATACCCTTGTTTTACATGCATTCCTGTGATACCCTTGTTGTGCATGAATACTTGGGATGTTCTGCATAATCCAATAATTGATTCATATAATAAGAAGCTTAAGGCTTACCTGATGTTTCTTATCAAAGCAGCCAGGACCCTGTCTGGAGCACATTGGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8014
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109062 Essential Splice Site 100 1275 4 15
ENSDART00000110841 Essential Splice Site 86 1234 4 19
ENSDART00000134978 Essential Splice Site 116 1480 5 12
Genomic Location (Zv9):
Chromosome 23 (position 24939706)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24725826
GRCz11 23 24652367
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGAGCTTCTGCAGGAGAAACTGCACAGTCAGTCTTGTGTACATCAGCAG[G/A]TAAATGATTAAAACTTGCAATGGAAAATGCACAGTGCATGCCTTCTAAGT
Long Flanking Sequence:
TTTTTTAGATATCGGATCGTTTTTCCTAATGCAGACAGTCAATTAGTCAGATAAATAAATAAAATATCCCTGAAAGTACACAATGTTAACATCATGTCTTTGATGTAGGTGGCCAACCATGTTGTCCAGGCTTTACTCAATCAAAAGGTACAAAAATTGTGTTTTTTCTTCAGCAACATGTTTGTAAGGTTTATTTAAACGGCAAAGATAAAAGGTTCTTTTTTATTTAATATGTTTATTAATTTATTATTATTTGTTATAAATAATCGATAATGATGATTTTTTTTTAAATTTGTGGTTGTATATTTTATAACTGCCATGCATATTTTAGCCATATGTTTTTCAGATGATTTATTTAATATTATGAATTATTCTTTTAGGATCTCAGAGAGGAATGCATCAAACTGAAAATGCGTGTTTTTGATTTGGAGAGGCAGAACAGAACACTGTGTGAGCTTCTGCAGGAGAAACTGCACAGTCAGTCTTGTGTACATCAGCAG[G/A]TAAATGATTAAAACTTGCAATGGAAAATGCACAGTGCATGCCTTCTAAGTTGATGTTTTTCACAAAACATTCTTCAAACTCCACTGGGATGACCTATTAGGTTTGTTTGCAAATTGGAGAAAATGGCTCAATTAACGTCTTCCTGTTTAATTTCCCTGTGCTCCTCAGGCAGCATTTTTTTTCCCTGTAATTACAAGAAATTTGTTTGTAAATGGGCAAATACCCTTGTTTTACATGCATTCCTGTGATACCCTTGTTGTGCATGAATACTTGGGATGTTCTGCATAATCCAATAATTGATTCATATAATAAGAAGCTTAAGGCTTACCTGATGTTTCTTATCAAAGCAGCCAGGACCCTGTCTGGAGCACATTGGTGAGCTACAGCAGAGTGAATCTACCAAACTGATTGAGGCTCAAAGGAATGCACAGGCCAAGGTAGGAGCCATACACAAAATCTTTGTTGAATCAATCTGAGATGACAAATTCCTTATTCTTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24336
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109062 Nonsense 226 1275 6 15
ENSDART00000110841 None None 1234 None 19
ENSDART00000134978 Nonsense 236 1480 7 12
Genomic Location (Zv9):
Chromosome 23 (position 24940493)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24726613
GRCz11 23 24653154
KASP Assay ID:
2261-7770.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACAATACATCCAGGTGCAATGCACCCAAAGCACATTGTTCCCATTCCTG[T/A]CCAGATGTTTGCACACATCAGCATTTGAATGGAGGAGAGCACAGCAATGT
Long Flanking Sequence:
AATCCAATAATTGATTCATATAATAAGAAGCTTAAGGCTTACCTGATGTTTCTTATCAAAGCAGCCAGGACCCTGTCTGGAGCACATTGGTGAGCTACAGCAGAGTGAATCTACCAAACTGATTGAGGCTCAAAGGAATGCACAGGCCAAGGTAGGAGCCATACACAAAATCTTTGTTGAATCAATCTGAGATGACAAATTCCTTATTCTTAGGATTTGTTTTCACAGGGTAACAGCGAATGTGCACAAAATTCCGTACCCGAGACTCAAGGCTCGTCCACATCCATGGAGGCCATGTCCCCATTCTTGAAGAAGAAAGCACACATTTTGGAGGTTCTCCGCAAACTTGAAGAAACAGATCCACTTCGGTACCATCGTTCCTCTGGCATTCCCTCCATCTGTGACTACAGTCAGGCTCTTGCCTCTAAGGAGGCTGTATTAGCCTGCAGAGACAATACATCCAGGTGCAATGCACCCAAAGCACATTGTTCCCATTCCTG[T/A]CCAGATGTTTGCACACATCAGCATTTGAATGGAGGAGAGCACAGCAATGTAAAGTGTGGTAGTTGTAGCACATGTTTGATGCTGTCCAATAAAGATTCCGTCAGCTTAGCCAAGAGTAGCCACAACTGTTGCACTTCAACCCCCATTACCATTGATAACCTCAATTTGGCTCGGCCCGATTTCCAAGAGAATGTGGAAATGCAGAGCCTTGTGAAACCTGCCACAGGTACAAGTGAACTGTTTGTAAACAGGACTTCTGGAGATATGTCGATTCTTTCAGCAGAGCAAGGTCTTATACCGTCAGTTGATCCTCACTCATTAGAAGCCCCTGAATCATACTCAAGATTGACTATTTCAGAAAGAGATCAGCCAAGGGGAGTCTCTGACCATGTGTTGGTAGATACAAGAGAAAAGAATAGGTTGTCTGATCTTCTCCTTGAGTGTCAATCCAACAGGTCAAGCAGCAGCACCTGTAATGAGACTATTTGTGACGATGGCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4248
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109062 Missense 973 1275 9 15
ENSDART00000110841 Essential Splice Site 930 1234 11 19
ENSDART00000134978 Missense 1156 1480 7 12
Genomic Location (Zv9):
Chromosome 23 (position 24943252)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24729372
GRCz11 23 24655913
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGTCAAGGAAAGGGACATTCATGTGAGGTAGTGATGGACCAAGCCCAAG[G/A]TCAGCTGTCTGTGATGTATAGAGGAGTGCCATCTGACAACTTCATGCAGC
Long Flanking Sequence:
CAATAAAAAGAAGAATTCTTCCTATGGAGAGAGTCTTCCTCCGCCGCCACCAAGGCCGGTAGAGGCCGTTGAAGAAAAGAGGCACTCGGCCCCCAGTCCTCAGTCTTCTATTGAGCAAAAGGTCATGAAGGGCATTGAGGAAAATGTGCTGAAGCTGCAAGAGCAAGACAAAGGTCAGGTGGTCGAGGTCAAGCAAAAGGCTTCCAATGGAATCGCCAACTGGTTTGGTCTCAGAAAAAGCAAGCTTCCAGCTCTTAGCCGTAAACCAGAAACCTCGAAAGTGAAAGATGACAAGAGAGAATGGAAACTCAATATATCCAAGGATTCCAAGGGGGCTGCGAAGAAACCTGAGAGTGAGAGCCTAAACATTTCAATGCTGATTGAGAAGGCAGAGGGCTTGCATAAAGCTCTTGAAGAAGAACGGGCTTATGTGAATGGAGTGGCGTTGGACCGTCAAGGAAAGGGACATTCATGTGAGGTAGTGATGGACCAAGCCCAAG[G/A]TCAGCTGTCTGTGATGTATAGAGGAGTGCCATCTGACAACTTCATGCAGCAACTTCTGAACCGGTCAGTACAAAACAACTTAGTGTCTTGTTGTTTTGACATTTAAAGATGGCCAATAACTTTTTTATTTTTTTTGCATTAGTCAGAAAAGCAACCCACAAATTAAAGGCCAAATTAGTTCATTCATAGTTGTAGTTCAGGTTTGTAAGTGATGAAAGGTATTTGAAATAACTTCTGAGTGAGTAAGGTGAGAAAATATGCTTCGAGACATAATTTGTATATGATTTGTAAGTCATCTGTTTGAGTTACTGGGAATTTGCGTCATTGTAAAGGCTGGGCTTTTTGGATTGGCTTAATAAATTTAAATGCATGAATTTGATTACAACCAAAATGTAAAATTTACTTTTATTTAAAAGTTTCTTTTTAAATTTTTTAATTTTTTTTTTTTTTACCAAACAACAACTAAGGGTGTATTGACATTCATTTTTTTTTTACTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30740
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109062 Nonsense 1032 1275 10 15
ENSDART00000110841 Nonsense 982 1234 13 19
ENSDART00000134978 Nonsense 1215 1480 8 12
Genomic Location (Zv9):
Chromosome 23 (position 24943872)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24729992
GRCz11 23 24656533
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCCAGACCTGTTTTTAGTCACCAGAGTGCTGCCATTGCTAGTCAGACA[C/T]GAAGCAGTGATGACATGGAAAAGGTAAGTTCAATTCTTTATTGTAGTACG
Long Flanking Sequence:
CTTTTTTATTTTTTTTGCATTAGTCAGAAAAGCAACCCACAAATTAAAGGCCAAATTAGTTCATTCATAGTTGTAGTTCAGGTTTGTAAGTGATGAAAGGTATTTGAAATAACTTCTGAGTGAGTAAGGTGAGAAAATATGCTTCGAGACATAATTTGTATATGATTTGTAAGTCATCTGTTTGAGTTACTGGGAATTTGCGTCATTGTAAAGGCTGGGCTTTTTGGATTGGCTTAATAAATTTAAATGCATGAATTTGATTACAACCAAAATGTAAAATTTACTTTTATTTAAAAGTTTCTTTTTAAATTTTTTAATTTTTTTTTTTTTTACCAAACAACAACTAAGGGTGTATTGACATTCATTTTTTTTTTACTTTTTCCACAAGGGTTGATGGGAAGGATACTAGTGGCATCAGTATGGCACATAGACGTCTCTCATTTGACTGTAAATCCAGACCTGTTTTTAGTCACCAGAGTGCTGCCATTGCTAGTCAGACA[C/T]GAAGCAGTGATGACATGGAAAAGGTAAGTTCAATTCTTTATTGTAGTACGTGTTGTTTTTGCACTTGGCAATACTTTTAATGTTACCTCGGCTATTTTTTTCACAGGTCTCTGCATTACTAAGTAAAGACGTCACGTCGGACGACAACCTGGCTGAGACAATTCATCATGAACACTTTGCAGGTCAGGCACTAGTACAATGCATGACATCATGGCTTTCAGTGTTCCCAGAGGCAGGAATTTTGACCGATTAGCATGTAGCAGCAAAAACGGGTTTTAACCTGTCATTGATGATGAGTAATCTAGGTGCGTCTGAATTTTCTCTGGCTTCCATATGCAAGTAATCCGGTAACATCTGTGTAGCACACATTTTATTGCTTATATACTTAGAGTGTGATGGTTTGTTACCTGGTTACATTGCCTTATAAATAAACATTTTTAATACATTTTTAGTTATATATTTTATATATAAATGCAGTTATATAATAATCAGAGGTGGAA
Associated Phenotype:
Not determined