Busch Lab

ZMP

smarcal1

Ensembl ID:
ENSDARG00000079146
ZFIN ID:
ZDB-GENE-041210-303
Description:
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A-like protein 1
Human Orthologue:
SMARCAL1
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1 [Sour
Mouse Orthologue:
Smarcal1
Mouse Description:
SWI/SNF related matrix associated, actin dependent regulator of chromatin, subfamily a-like 1 Gene [

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34775 Essential Splice Site Available for shipment Available now
sa34776 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34775
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038508 None None 587 None 25
ENSDART00000112984 Essential Splice Site 348 522 6 10
ENSDART00000122786 Essential Splice Site 251 699 6 18
ENSDART00000127514 None None 250 None 13
ENSDART00000136437 None None 269 None 4
Genomic Location (Zv9):
Chromosome 9 (position 53954612)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 52938824
GRCz11 9 52479727
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCCACAACTCACACGCAGCCTCATGCCTTTCCAGAGAGACGGAGTCAA[G/A]TACGTTAACTTTAATTTATTGAACAAGTTTGACAAATCGAGATTGCAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34776
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038508 Essential Splice Site 277 587 10 25
ENSDART00000112984 None None 522 None 10
ENSDART00000122786 None None 699 None 18
ENSDART00000127514 None None 250 None 13
ENSDART00000136437 None None 269 None 4
Genomic Location (Zv9):
Chromosome 9 (position 54003072)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 52938824
GRCz11 9 52479727
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCCACAACTCACACGCAGCCTCATGCCTTTCCAGAGAGACGGAGTCAA[G/A]TACGTTAACTTTAATTTATTGAACAAGTTTGACAAATCGAGATTGCAATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27497
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038508 Nonsense 361 587 12 25
ENSDART00000112984 None None 522 None 10
ENSDART00000122786 None None 699 None 18
ENSDART00000127514 None None 250 None 13
ENSDART00000136437 None None 269 None 4
Genomic Location (Zv9):
Chromosome 9 (position 54010162)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 52934042
GRCz11 9 52474945
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTAAAGGAAAAGACAGCCTGCGCTCCGGCCTCATCAACATCATCAGCTA[T/A]GACCTGCTCAACAAGATGGACAAACAGCCGCCGTCCAGCCCATTCAACGT
Associated Phenotype:
Not determined