Busch Lab

ZMP

SPTBN1 (1 of 2)

Ensembl ID:
ENSDARG00000079113
Description:
spectrin, beta, non-erythrocytic 1 [Source:HGNC Symbol;Acc:11275]
Human Orthologue:
SPTBN1
Human Description:
spectrin, beta, non-erythrocytic 1 [Source:HGNC Symbol;Acc:11275]
Mouse Orthologue:
Spnb2
Mouse Description:
spectrin beta 2 Gene [Source:MGI Symbol;Acc:MGI:98388]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa21980 Nonsense Available for shipment Available now
sa13420 Splice Site, Nonsense Available for shipment Available now
sa35161 Nonsense Mutation detected in F1 DNA Not yet available
sa35162 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa21980
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049651 Nonsense 98 517 2 7
Genomic Location (Zv9):
Chromosome 11 (position 44132829)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42866757
GRCz11 11 43158838
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATGCCTCTTGCTACGTCAACAGATCATGGCAACAATTTACAGACTGTT[C/T]AGCTATTAATCAAGAAAAACCAGGTAATGCATTTTGGGCCTCCTCTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13420
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049651 Splice Site, Nonsense 243 517 5 7
Genomic Location (Zv9):
Chromosome 11 (position 44139268)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42860327
GRCz11 11 43152408
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAAAAACTTTCGTGATTTTCAGTAACTTTGACTCTGTGTGTGTYGTAGT[G/T]AGAGGATTGGCATGCGTCAGTCRCAGGTGGATAAACTGTACGCTGGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35161
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049651 Nonsense 256 517 5 7
Genomic Location (Zv9):
Chromosome 11 (position 44139309)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42860286
GRCz11 11 43152367
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTGTAGTGAGAGGATTGGCATGCGTCAGTCACAGGTGGATAAACTGTA[C/A]GCTGGACTGAAGGATCTGTCGGAGGAGAGGAGAGGGAAACTGGAGGAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35162
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049651 Nonsense 354 517 6 7
Genomic Location (Zv9):
Chromosome 11 (position 44139746)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 42859849
GRCz11 11 43151930
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCGGACGAACTGATCAACGCTGGTCATGCAGACGCCGCAACCGTAGCC[G/T]AGTGGAAGGACGGTCTGAACGAGGCCTGGGCGGATCTGCTGGAGCTCATC
Associated Phenotype:
Not determined