Busch Lab

ZMP

si:ch211-196g2.6

Ensembl ID:
ENSDARG00000079079
ZFIN IDs:
ZDB-GENE-081105-102, ZDB-GENE-081112-3
Description:
sulfotransferase family 1, cytosolic sulfotransferase 7 [Source:RefSeq peptide;Acc:NP_001132953]
Human Orthologues:
SULT1A1, SULT1A2, SULT1A3, SULT1A4, SULT1B1, SULT1C3, SULT1E1
Human Descriptions:
sulfotransferase family 1E, estrogen-preferring, member 1 [Source:HGNC Symbol;Acc:11377]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 [Source:HGNC Symbol;Acc:11453]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 [Source:HGNC Symbol;Acc:11454]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 [Source:HGNC Symbol;Acc:11455]
sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 [Source:HGNC Symbol;Acc:30004]
sulfotransferase family, cytosolic, 1B, member 1 [Source:HGNC Symbol;Acc:17845]
sulfotransferase family, cytosolic, 1C, member 3 [Source:HGNC Symbol;Acc:33543]
Mouse Orthologues:
Sult1a1, Sult1b1, Sult1d1, Sult1e1
Mouse Descriptions:
sulfotransferase family 1A, phenol-preferring, member 1 Gene [Source:MGI Symbol;Acc:MGI:102896]
sulfotransferase family 1B, member 1 Gene [Source:MGI Symbol;Acc:MGI:2136282]
sulfotransferase family 1D, member 1 Gene [Source:MGI Symbol;Acc:MGI:1926341]
sulfotransferase family 1E, member 1 Gene [Source:MGI Symbol;Acc:MGI:98431]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa7283 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7283
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113214 Splice Site None 301 None 8
ENSDART00000146985 Nonsense 13 270 1 7
Genomic Location (Zv9):
Chromosome 8 (position 48609703)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46447961
GRCz11 8 46455840
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTGTCCTCTTAGTGMAGTAAMGCTTCATMACTAACAATTTTAACMCTR[C/T]AGATTRAATYACCCAGTMGACCTRAGATRTTWRAATTTGMGGGTATCYCA
Long Flanking Sequence:
GAGTACCTTTGGAATGTGATGGAATGGGAGATTCGCATCATGGATGTGCAGCCGACAAATCTGCAGCTACTACGCAACTAATGCTAGCAAAAAATCTCTGAGGAATATTTTCATTACCTTGTTGAATCTATACAACGAAAGATTAAAGCAGTTCTGAAGGCAAAATGGGGTCCAACCGACCCGGTACTAGTAAGGTGTACTGCACCTAATAAAGTGGACAGTGAGTATAAGTGCAGTACAGTAAACCGTAAAGATTTTGTGTTTTTATTTATCAGTTCTGGCATAAAGATACTTCAACATTATAAATATGATTCTCAAGAAATATTTAAATTGAATTTTACTCTTAAAGTAACAGCTTGATTCTTCTGTCCATATATTTTTCATGTTTTTGTAAGTGTAATCTGAAATTGTACTTGTTTAATGGTTTTAATCTTATTGATGCGTTTATCATTTTGTCCTCTTAGTGAAGTAAAGCTTCATCACTAACAATTTTAACCCTA[C/T]AGATTAAATCACCCAGTCGACCTGAGATATTTGAATTTGCGGGTATCCCAATGATCAGCTACTTCACTAAGAACTGGGAAAAGTTGAAAAACTTTCAAGCAAGACCTGATGACATTCTAATCGCAACTTACCCCAAAGCAGGTAGAGCACTGAATTAAATTTTTTTTTGTATATTATGTGACCACTAAGCCCCTGTTAAAAAAATGTGATCAGGTTTTTTTGTTTTTAATAAAGTAAAAAAAAAAAAAAAAACGAATAAAGCAAGTATTTATTAGATTGATTAAATTTGCCAGAAAAAAAACTTGGAGCCCGTAATGTAGCGCCAGGTGGGACATAAGATGCTTTTTACTTTCAGCGAGGTGCAGGTATCATTTTCACATCCTGCGCATGTTGTTTAAACAGCATACCTGTATGCGTTTGCACTCATTGGAACACCTATTTGTTGTGCTGGTCTGAAAAGGATGTTTGGTAAGGTGCATTGTTGTTGTGTTGCTATTGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3652
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113214 Essential Splice Site 54 301 2 8
ENSDART00000146985 Essential Splice Site 59 270 1 7
Genomic Location (Zv9):
Chromosome 8 (position 48609561)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 46447819
GRCz11 8 46455698
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTCAAGCAAGACCTGATGACATTCTAATCGCAACTTACCCCAAAGCAG[G/A]TAGAGCACTGAATTANNNTTTTTTTTGTATATTATGTGAYCACTAAGCCC
Long Flanking Sequence:
TTAAAGCAGTTCTGAAGGCAAAATGGGGTCCAACCGACCCGGTACTAGTAAGGTGTACTGCACCTAATAAAGTGGACAGTGAGTATAAGTGCAGTACAGTAAACCGTAAAGATTTTGTGTTTTTATTTATCAGTTCTGGCATAAAGATACTTCAACATTATAAATATGATTCTCAAGAAATATTTAAATTGAATTTTACTCTTAAAGTAACAGCTTGATTCTTCTGTCCATATATTTTTCATGTTTTTGTAAGTGTAATCTGAAATTGTACTTGTTTAATGGTTTTAATCTTATTGATGCGTTTATCATTTTGTCCTCTTAGTGAAGTAAAGCTTCATCACTAACAATTTTAACCCTACAGATTAAATCACCCAGTCGACCTGAGATATTTGAATTTGCGGGTATCCCAATGATCAGCTACTTCACTAAGAACTGGGAAAAGTTGAAAAACTTTCAAGCAAGACCTGATGACATTCTAATCGCAACTTACCCCAAAGCAG[G/A]TAGAGCACTGAATTAAATTTTTTTTTGTATATTATGTGACCACTAAGCCCCTGTTAAAAAAATGTGATCAGGTTTTTTTGTTTTTAATAAAGTAAAAAAAAAAAAAAAAACGAATAAAGCAAGTATTTATTAGATTGATTAAATTTGCCAGAAAAAAAACTTGGAGCCCGTAATGTAGCGCCAGGTGGGACATAAGATGCTTTTTACTTTCAGCGAGGTGCAGGTATCATTTTCACATCCTGCGCATGTTGTTTAAACAGCATACCTGTATGCGTTTGCACTCATTGGAACACCTATTTGTTGTGCTGGTCTGAAAAGGATGTTTGGTAAGGTGCATTGTTGTTGTGTTGCTATTGTGGTTTAAACTGAAACAGACAACACTATAAGCCAGTTTAAAGCTGGTCTAAATTCAACAGCACAGCTTTTTGTTACTGTTTTTTTACATTAGTGATAGGCTGGTCAAAACCCGCATACATAATACTTATTACAAACCCGGGGAT
Associated Phenotype:
Not determined