Busch Lab

ZMP

si:ch73-173k21.1

Ensembl ID:
ENSDARG00000079074
ZFIN ID:
ZDB-GENE-090313-137
Human Orthologue:
FRMPD1
Human Description:
FERM and PDZ domain containing 1 [Source:HGNC Symbol;Acc:29159]
Mouse Orthologue:
Frmpd1
Mouse Description:
FERM and PDZ domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2446274]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa19485 Nonsense Available for shipment Available now
sa15183 Nonsense Available for shipment Available now
sa39603 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32657 Nonsense Available for shipment Available now
sa19484 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19485
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114719 Nonsense 187 1757 6 15
ENSDART00000139937 None None 122 None 3
ENSDART00000140553 Nonsense 49 267 2 7
Genomic Location (Zv9):
Chromosome 1 (position 20734977)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21207073
GRCz11 1 21900010
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACCTCCAGGGCAATTCTCTGCTGTTCCTGCCTAATGTTCTGAAGGTCTA[T/A]CTGGAGAACGGCCAAACGAAGGCTTTCAAGTTTGAATCTAAAACCACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15183
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114719 Nonsense 230 1757 7 15
ENSDART00000139937 None None 122 None 3
ENSDART00000140553 Nonsense 92 267 3 7
Genomic Location (Zv9):
Chromosome 1 (position 20731945)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21204041
GRCz11 1 21896978
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAAACTGTCAATAACCCGTATAGAACACTTCTCYCTAGTACTGGAACAA[C/T]AATACAGCATMAGCAAACTCTATCTACTGCATGAGGAAGAGATTATTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39603
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114719 Essential Splice Site 287 1757 8 15
ENSDART00000139937 None None 122 None 3
ENSDART00000140553 Essential Splice Site 149 267 4 7
Genomic Location (Zv9):
Chromosome 1 (position 20730343)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21202439
GRCz11 1 21895376
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGCATGCTTACAGAAGATCCTGTGGGCTTTGAGTATCTGTACTTACAG[G/A]TGAGTGTTTCTTTCATGTTAGTTTCCTGCTATAACCACTAGTAAATGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32657
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114719 Nonsense 755 1757 14 15
ENSDART00000139937 None None 122 None 3
ENSDART00000140553 None None 267 None 7
Genomic Location (Zv9):
Chromosome 1 (position 20721664)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21193760
GRCz11 1 21886697
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGCTGAATGTCTACCTAGTCCCCCTGCAGCCAGCGAAGAGGAAGACTG[T/A]GAGGAGTCAGGAATAGAGAATGAAAACCATAAAAAGGAGTCACCTGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19484
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114719 Nonsense 790 1757 14 15
ENSDART00000139937 None None 122 None 3
ENSDART00000140553 None None 267 None 7
Genomic Location (Zv9):
Chromosome 1 (position 20721561)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21193657
GRCz11 1 21886594
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCTGAAAGCAACCTACCCCTTCCTGCAGATTATGTGTTCACATTTGAA[C/T]AAGGAGACACTAGACATTACTACAATATCTGCTCCAATGTTACTCCTGAC
Associated Phenotype:
Not determined