Busch Lab

ZMP

jam2b

Ensembl ID:
ENSDARG00000079071
ZFIN ID:
ZDB-GENE-080229-3
Description:
junctional adhesion molecule 2 [Source:RefSeq peptide;Acc:NP_001121766]
Human Orthologue:
JAM2
Human Description:
junctional adhesion molecule 2 [Source:HGNC Symbol;Acc:14686]
Mouse Orthologue:
Jam2
Mouse Description:
junction adhesion molecule 2 Gene [Source:MGI Symbol;Acc:MGI:1933820]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa21536 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21536
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111437 Nonsense 15 306 1 10

The following transcripts of ENSDARG00000079071 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 35967625)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 35187136
GRCz11 9 34996321
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTCCACATGCTCCTGCAGCAGCCGTACATCACGAAGATGAAAACAAAA[C/T]AACTACTAACCTCTGCTCTTCTCCTGCTTATTTACAGTAAGTATCATGAT
Associated Phenotype:
Not determined