Busch Lab

ZMP

DOCK9 (3 of 3)

Ensembl ID:
ENSDARG00000079069
Description:
dedicator of cytokinesis 9 [Source:HGNC Symbol;Acc:14132]
Human Orthologue:
DOCK9
Human Description:
dedicator of cytokinesis 9 [Source:HGNC Symbol;Acc:14132]
Mouse Orthologue:
Dock9
Mouse Description:
dedicator of cytokinesis 9 Gene [Source:MGI Symbol;Acc:MGI:106321]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa21413 Nonsense Available for shipment Available now
sa27315 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa7169 Nonsense Mutation detected in F1 DNA Not yet available
sa34539 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa21413
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017904 Nonsense 147 1207 5 32
Genomic Location (Zv9):
Chromosome 9 (position 1248931)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1258085
GRCz11 9 1092182
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAACTGCAATGATCTGTCCTTCAACCTGCAGAGCTGTGTGGCGGAGAAT[G/T]AAGAGGGGCCGACCACTAACGTAACTCACCAACACACCACACTGAAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27315
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017904 Essential Splice Site 214 1207 6 32
Genomic Location (Zv9):
Chromosome 9 (position 1249329)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1258483
GRCz11 9 1092580
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCCAGAGAAAACAACCCAGCAGAGAGCGCTGTTCACTACCCACGCCAG[G/A]TCAGACAACACAACACAACACCTGGCCCATAACCGAGAGACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7169
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017904 Nonsense 661 1207 20 32
Genomic Location (Zv9):
Chromosome 9 (position 1266357)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1275511
GRCz11 9 1109608
KASP Assay ID:
554-4447.1 (used for ordering genotyping assays)
KASP Sequence:
TGTWAAAGCATGTTTCCCCTCATSAATGTGYCAGATCTGCAGCTGGATTA[C/A]TCTCTGACGGATGATTTCTGCAAGAATCACTTTGTGGTGGGTCTGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34539
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017904 Nonsense 693 1207 20 32
Genomic Location (Zv9):
Chromosome 9 (position 1266451)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1275605
GRCz11 9 1109702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGCTGCGGGAGGTGAGCGCAGCCGTGCAGGAGTGCAGAGACATCCGG[C/T]AGATCAGCATAGCAGTGCTCAAAAACCTGATGATCAAACACGCTTTCGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3745
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017904 Nonsense 765 1207 22 32
Genomic Location (Zv9):
Chromosome 9 (position 1267908)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1277062
GRCz11 9 1111159
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGTGNTTTTTTTCAGAATGGCCGTGATGATCATTTAATGACGCCTCAC[A/T]AAACTGCGGGCAGTCCAGTGGACGGTGGCCTGCATAAAGAGCTGTTTGGA
Associated Phenotype:
Not determined