Busch Lab

ZMP

si:ch211-166e11.5

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9936 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9936
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112682 Nonsense 12 594 1 6
ENSDART00000132750 None None 566 None 5
Genomic Location (Zv9):
Chromosome 9 (position 177943)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 306567
GRCz11 9 306200
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTTGGTCGTGCGATATGACGTCACAGGCGCGAGCCGCGCTCCCGTGTT[T/A]GTGGTTCGGCTGGAGAAAGGTTTGTGTTTTCRAGCGTTTAAAGTGTTTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27304
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112682 Essential Splice Site 18 594 1 6
ENSDART00000132750 None None 566 None 5
Genomic Location (Zv9):
Chromosome 9 (position 177964)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 306546
GRCz11 9 306179
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCACAGGCGCGAGCCGCGCTCCCGTGTTTGTGGTTCGGCTGGAGAAAGG[T/G]TTGTGTTTTCAAGCGTTTAAAGTGTTTAATTCGACAAGTCTATTGTATAC
Associated Phenotype:
Not determined