Busch Lab

ZMP

wu:fi38e01

Ensembl ID:
ENSDARG00000079034
ZFIN ID:
ZDB-GENE-030131-6199
Description:
LOC798996 protein [Source:UniProtKB/TrEMBL;Acc:A9JRE5]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa38603 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17140 Nonsense Available for shipment Available now
sa31564 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38603
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111719 Essential Splice Site 40 833 3 19
Genomic Location (Zv9):
Chromosome 7 (position 21740068)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20330504
GRCz11 7 20582472
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGTCTGTGTTTGTCTCATTTTTTTATTTTATTTTTTCTCCCCTCCCTA[G/A]TTCCCATTCAGGTGGAGTGCAAGGCCCACTATTTGTTAGTCTCCGTAGAC
Long Flanking Sequence:
AAGCCTTACATTTGCCCTAACAAGCACAGCTGCTGCTGAAGTAGCCAATCAAACACGCCTACTGCCTAACAAGTCAATTACCCTGACACGTTTAAAACCCAGTCAGCAGGCAGTAGATTTGTACTCTAAGCCGTTTTGCTTAGGATATTGCGGTTTAGTGCTAATGTAGTTTTGGTTCTAATATAAGTTACCATACTACAGACACTTCTGGTAATCAGTGGCCATGGCGTTAGAGTTTGTTACAGGGTAATTTATTTTACTTGGAGTATGTTTGTAATTATAATAGGAATCAAAATATAACTTTGTTTCTGTCTTTGTAGAGGGTTACTTCTCCTGTGTGCAGTAGCTTTTGCTCTTCCTGACTTCAAAGGTTCACTTCAAGGTTCATTTCAACAGTCTCTTGTGCAGCCACAAGGTAAGAGCTTACCAGAAAGCATTATCACCAAGTTTAATGTCTGTGTTTGTCTCATTTTTTTATTTTATTTTTTCTCCCCTCCCTA[G/A]TTCCCATTCAGGTGGAGTGCAAGGCCCACTATTTGTTAGTCTCCGTAGACATGCCACCATCTGGTCTGAAGCCTCGTTTTGAGGCCGTTGGTGTGTTTTGCTGCTTTTGTTATATTTTAGTGGTTTTTGAGTTCTAAAGCTTGTAAGATGTCCTCACCCTATTTAACCAAATTTCTATTGTCTCAGATGCTGCAGGTGCATATTCTATTACGGAGCGCTATGCGGCTCAGTGTGGTTATACTTACTCTGTCCAGCCTCTTCAAGGTCGTGTTTTTCTCAGAGCCTCTTATTTCTCCTGTCATGTGGACAATCAGGTATAGAACATGGACTTACTTACTGGTGGACCACTTTCAGGATGGTCGTCATCTAGTTCCTGCTACTGGCTGGGATTCGTATATAATTCCGCAAAGATTCCTTGACTAAAGACTTATTCCATTACTTTTTTTTTTTTTTTTTTTTTTTTTTGGCTCACGTTTCTTGTTTTGGAAGAGCATTTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17140
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111719 Nonsense 205 833 7 19
Genomic Location (Zv9):
Chromosome 7 (position 21738889)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20329325
GRCz11 7 20581293
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCAGTAGAGGCCTGGCAGRTTATTCWACAACAAGAGGGACAACRATCC[A/T]AAGTTATGTCAACWGAAGAGGCTGCTTCTCTGGGGTAYACTGTAATGGGM
Long Flanking Sequence:
GGATTACAAATGTTATCTATGATACCTGAAGCATGAAGTGTAATCTTGAGCAAGTAACTTTATTTATTTTTTAATTCCTTCAAGATTGACAAGGTCTTCAACTTCATGTTTCGTGTGGTTCTTGCGGATCAAAATGGGCTGGAATCCTTTTTCAATGTCTCTCAGACTTGCACTATTCATACTTTCTCTCCAAGAGAAGTTGTTTGTGAGGAGAACTACCTGGAGGTATGAGTTGATCTTTATGTAATGCTTATGTCCTACCAATCTTAAACCCTTGCTTCTCAATCATCTAGGTGTCTGTGAAGGCGGAGATGCCTTGCCTTTCAACTAGCATCATGAAGGCAGAGTTCTCTGAAACCCATGCTGTGGTGGGTAGTTTGCTCTTGTCCAAGTCTTTCAATTAAAGAGACTTTGGTTCCAATTGCTTTTCTCTCTTCCAGGCCCACAGTTCAGCAGTAGAGGCCTGGCAGGTTATTCTACAACAAGAGGGACAACGATCC[A/T]AAGTTATGTCAACAGAAGAGGCTGCTTCTCTGGGGTACACTGTAATGGGCACATCTGGCAGACTTGTTTTTCGGACTGCCTATGGTCAACCTCATGCAACTGTCAAAATGGTATGGAGATTTGATTTGAACTGATTGGTCTGTTCCTTAACTTTGTTTGCACTAACATTTGACTATTGCATCAAACTTAATTCAGGTCAATGATGTCGCAGTTGAAGTGATCCATGCCACAGTGTTTTTCAGACAGACCTGGATGGTGGTCATGATGGACCTAGTTGCATCGTGCTCAAGGGGTAACGACCACTTGTATTAGTCATTTGCATTACTGAAAGGCACAATGAATTCAGGTGCTTTATTTCAGCATTGCTTGTAATTCCAGATGAAGGTCGTTTTGATGGCTTCAGACTTCAGTGGAGAACTCCTGCAATAATGACTCCACTGGCTGTAGGACTTCCTGTCTTGAGGACAGAGTACATGGCCATAGGTGTTGATGGTGAGATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26930
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111719 Essential Splice Site 509 833 13 19
Genomic Location (Zv9):
Chromosome 7 (position 21737454)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20327890
GRCz11 7 20579858
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCAAATTAAAGTTGTCTGCTTTGCACTGATGGCTTTTCAACTTTCAAC[A/T]GCCCCTCCAGTCTTTGAGAGCACGTGTGCTGCCAACGGCGTAAGCTTCAG
Long Flanking Sequence:
GGCAATGTACCTACTGATGTGGAACTGGTGGCTATGGAGTTTAATGGACAGGAGATCTCTGTACTGACTGCCATCCAGATGGGCTATTCTGTCACTAGAGTCTCTGAAACAAATTTAACCTTTGCATACATCATTAGGGTGCCGTTTCAGGACCAGTTTGTTGTGAAAAAGGTGAGTGGGTATAGAACTGCAGCTCAAAGAAATTACATTTTTAGTGGGTGCTACAATGGTTATGCGGGCCACATTAATGTAAATCAAATTTAACCAAATTTTTTTTTTTTTCCCCCCCCTTTACGGTGTCTTAAGTTTGTTTCAGAGGGTGTTTTTGAGTACGCGTTGAATGTTAAATGGACTTTGAACATCCTTCCTCAAATGGAGACATATTACCACTATTCCTTTGTGTCTGCTGTGGTTATTAAAGCCTGTAAGAACCTTTAATTCAGGTTTTTCATTCAAATTAAAGTTGTCTGCTTTGCACTGATGGCTTTTCAACTTTCAAC[A/T]GCCCCTCCAGTCTTTGAGAGCACGTGTGCTGCCAACGGCGTAAGCTTCAGGAAGGAGCATCGTGGCTATGATCATTTGTGGGACTTTGCTGTTGGGCGTCACAGACTGACCCCACAACTGATGTCAGAGCGTGGATATATCGTGACCAATGATAGCAGCGCCTTAATAATGGATATCCCTCTATTTACAGCTGGATACACATATGAGGTCTGTTAAGCACTTGCAGGATTTAAAGAGTGCCCCCCTCTCTCTTCCCCCTCAATTGCCCTTTCAGTGTCTGCCTGTAGATAACCTTATGGACCTTACTTTGTTACAGGATATTACTCTACAACAGTTCTCTGCCAAATTTGAGATTTTCACAAGAAATGCTAAGACGCTGGAAACTGTGCAATCCTCAGCTAGACGCTGTCTCTTCCAAACCACAGAGCTCTTGGGTAATGGTCCTGGTGTACTTGTGAAGTGTCTTTTGTTGAATATTATGGGTCTTAAGCTTGAGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31564
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111719 Essential Splice Site 831 833 18 19
Genomic Location (Zv9):
Chromosome 7 (position 21735421)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20325857
GRCz11 7 20577825
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAGCGTATGGGCCATTTGCGCTGGTCTGAAAACAAGCATTCTCCTAGG[T/C]GACTTGTAACTTTAATTTTCATATTATATTAATTCTAATGACCCATGTAA
Long Flanking Sequence:
GGCAAAATCAAGCTCTGATTGTTCATGTGCCACTTATCTCTCTCTACTTCCTCCAGGGTGATTGTGAAGTGCATTTACCCAGTACGTTACCTTGAAACCCTTTCAGTGGACCTGAGGTTCAAAGTTGATGTAGCTGGAATTGGAGTAATTCAGTCTGTTATGGGTAAGTTGAAAATCTTGTGTCTGAACTTAATTTGACTGCAGTAAGTCATTTCGTTTTTTCTCTTTCAGCTCCTCCTAAAATTGTTGAGACTGTGCAAGTTCAGGAAAGTGCTGTGTATCGCCCATCTTTTCAGGCAACTGTTATAGAAAAACCAGTGCAAGTCCAGGAAAGTGCAGTTTTGCGTCCATCTTTTCAAGCAGCCATTGTTCAAAAACCAGTGCGAATCCAGGAAAGCACTGTTTTGCAGCCATCTTTTCAGACATCACTCATACAAAAACCAATTAACTACAAGCGTATGGGCCATTTGCGCTGGTCTGAAAACAAGCATTCTCCTAGG[T/C]GACTTGTAACTTTAATTTTCATATTATATTAATTCTAATGACCCATGTAACCTATTCTCTTTCTTTCTCCCCCCCACAGGACAAAATAGAAACTTTTTAAATTTGAACTGAATAAACATCTTAAGACTTGATTTATGTGTGGTTTCATGTTTGAAATGAAATTCTAAGTACTACTTCCTGGTGTCTGTTGACTCTGTAAAAAGATGTGACCATTCTTGAAAGCTGATCTTTTAATGAGTTGTATTAAGGCTTTAAATCAAACTGTACAAGTCAGTTTAGCAAAAGTCAGTTATTGAGTATCAGTCCATGGCTTACCGACACTGTCGTGAATGGCCAAGTGAAGTCCATTTACCAAAGAGCTTCTGTTATAGAAAAGGCCACTAGTTTCTACACCATGCAGGGAGCTCCATGTCTGATGTCCAGTGTGGAGTGGTAAAGGAGTTGCTTTGGACACGATCTGAGGGTTCTGGGTGGGAGTCATGCAATTGGTGCTACTGGTT
Associated Phenotype:
Not determined