Busch Lab

ZMP

fkbp3

Ensembl ID:
ENSDARG00000079018
ZFIN ID:
ZDB-GENE-030616-419
Description:
peptidyl-prolyl cis-trans isomerase FKBP3 isoform 1 [Source:RefSeq peptide;Acc:NP_001004519]
Human Orthologue:
FKBP3
Human Description:
FK506 binding protein 3, 25kDa [Source:HGNC Symbol;Acc:3719]
Mouse Orthologue:
Fkbp3
Mouse Description:
FK506 binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1353460]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32320 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3076
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114387 Essential Splice Site 97 188 7 12
ENSDART00000127321 Essential Splice Site 130 221 12 17
ENSDART00000144632 None None 73 None 3
Genomic Location (Zv9):
Chromosome 20 (position 54642123)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54472335
GRCz11 20 54251518
KASP Assay ID:
554-2991.1 (used for ordering genotyping assays)
KASP Sequence:
AGGTGTTTTAATGAGCTGTATTGCTGTAGGCTGATCTCAGGTCAGCTGCT[G/A]TAAGTGATCTGGATGTTGATATGTTTGCTCATGTTGATTCTCTTCTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32320
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114387 Essential Splice Site 113 188 10 12
ENSDART00000127321 Essential Splice Site 146 221 15 17
ENSDART00000144632 None None 73 None 3
Genomic Location (Zv9):
Chromosome 20 (position 54641848)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54472382
GRCz11 20 54251471
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
NNNNNNNNNGATCTGGATGTTGATATGTTTGCTCATGTTGATTCTCTTCT[G/T]GTCTTTCAGCTGCAAAAAAGAAGAAGCAGTCGAAACCGCTGAGCTTTAAG
Associated Phenotype:
Not determined