Busch Lab

ZMP

col17a1b

Ensembl ID:
ENSDARG00000079011
ZFIN ID:
ZDB-GENE-030131-7145
Description:
Novel protein similar to vertebrate collagen, type XVII, alpha 1 (COL17A1) [Source:UniProtKB/TrEMBL;
Human Orthologue:
COL17A1
Human Description:
collagen, type XVII, alpha 1 [Source:HGNC Symbol;Acc:2194]
Mouse Orthologue:
Col17a1
Mouse Description:
collagen, type XVII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88450]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa31930 Essential Splice Site Available for shipment Available now
sa6300 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22298 Essential Splice Site Available for shipment Available now
sa18664 Essential Splice Site Available for shipment Available now
sa22299 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31930
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021053 Essential Splice Site 36 1542 2 57
ENSDART00000134102 None None 1368 None 51
ENSDART00000137074 None None 170 None 6
Genomic Location (Zv9):
Chromosome 13 (position 24976415)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24622075
GRCz11 13 24752525
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCACTGAAACAACAATCTCTACTTCTAGAGTCACATCTTTACCTCCTCG[T/C]AAGTTGCCCATATTTACCATTCACTACTCATTATATCTTTCCTCTATGTC
Long Flanking Sequence:
TTTAATTTCGGATCTCAAAAACGTTTAGTAAGATTTTTTGTAAGATTTTGTTGAAAATATCTGCTAGAATTTCCATTAGTTTCCAGTGTTGTCAATGATCATTTTTAATTTATTTATTTACTTGTCTTTATATGGCAAGTGCCTAATATTTTTGCCTTAAGTCAATTTTACTGATCTTAACATCTAATTTATTGATTTTGCTCATTTATTTAGTATGGGATGGACGATTTAAGACACCAAAGAAACTATACCGGAGGGAGTTTAGGAGACAGAGGTAAGGATGTTTGATAATTGAGTGAATTTGACATTATTTAATCGACGAATCTGAACCCAAAATCAGTTTATTGTGAACGCTGTGCCATCTAGTGGTTATTTAATAGGCTATTATAGAGAAACTTGTAATAATATTCCTGCTGCGCACATAATATAACATGTATTCTGAAAACAGGCTTCACTGAAACAACAATCTCTACTTCTAGAGTCACATCTTTACCTCCTCG[T/C]AAGTTGCCCATATTTACCATTCACTACTCATTATATCTTTCCTCTATGTCTTTAATTTATACTTTTTATTACTTTTATCATTTCCTTTCATGTTTGGCATACTGTGTATAGTATGTAACTTTTTTAGTCAGGTCAAAGTGGACTTTGTTATGATTTATTGTGTTTTTAACCCCAGGAGGCTTCAGTTCATCCACCAACAAGGGCATGTCAAGCAGCTCTGGCTCTCCAAGCCTGCTGGAGAAAAACATTTTGACACAAAACAACAGCGGCTCCTTTTTCTCATCATGTAAGTCAATATAAGAGCTATTTAAGAGCTATACAATAAACTGCTTCAGGGTTTTTTTCAGTAATTTGTTGCAGTATTTTTAATATACATTTTTTTTAAAAAACTCTGCATGGTGCCGTTTCTGTAACAGTCAGAAATTAAATATTTCTTTTTCAAAAAAATAAATGATTATAAAAAAGATCAGTATTTTACACATTTTAGTAATATTTTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6300
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021053 Essential Splice Site 299 1542 9 57
ENSDART00000134102 Essential Splice Site 125 1368 3 51
ENSDART00000137074 None None 170 None 6
Genomic Location (Zv9):
Chromosome 13 (position 24979723)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24625383
GRCz11 13 24755833
KASP Assay ID:
554-4405.1 (used for ordering genotyping assays)
KASP Sequence:
ACYGGAGCTTCACTGATCAGCAGCAGCACATCCCCATCCTCCTTATCAGG[T/C]CTATRTAAATGATCACTTATTTRCTATGTTGACCTGACAAAATGTGGATT
Long Flanking Sequence:
GAAGTTGTTGAAGACCTCTCGCTCCGCTAGCGTCAGCCCCACACGATCACCCTCCTCATCCCCTCTGCCAATCCCACGCAAGGCTACCACCTTAGACACCAAGACCTCCAGCAAACAAGGTAATGAAAGCCGCATTACAGGTGATCTTATTATATATGTGATTAGTAAAGCTTCATTAAACCATTAGGTCTTTCTACAGTTCACACACTTAGTTCTGTTGTACAGAGTGTGTTTATTTTCATGCTCAGCAACATTCTAAATTCCTGAGTTCATTGATGCATTTCAAAGCATTAAGAGCTCTTTTCAATCTTCTCAGTGGAGCAATACGACAGCAGTTTTCTCGAAGCAGATCTGGCCTCATACACCTGGAACAGCTCCACACTACCCTCTGCAGTCTCCACTGGCACCGCCACTGCTTATGGCTTTCAAAGTAACACCAACAATATGGCAACTGGAGCTTCACTGATCAGCAGCAGCACATCCCCATCCTCCTTATCAGG[T/C]CTATATAAATGATCACTTATTTACTATGTTGACCTGACAAAATGTGGATTAGCCATGATTAACCATGTGGATGGATGATAACAGCCTAACGGTAGGTGCAGAAGGCTCCTACTGGCCCATATCTGTCAGCTGATAACTACTGATAAAGCCCATTCAATAGAGTGATAACATTTAAAGCGGGTGGAAAATGTACACGTCTGCTCTTTTTCTTTCAAAAATGATGAGAACTTAAAATGTTTTTAGCTAATTCATAGCTTTTTGGATGCATTGACATGGTCAAACTACATTACTGATAAAAGTACAAAAAATGTATCAGCAATGCCATAGAAGGACAATGTTTTATTCCCTAAAAACCTTTCAGTTCCTGAAATCTTTTATTTGTTGTTTTAAAATGAAAATGTTCAAATGAACCTTCCCCATTTTAAAAGTGTTTTTTGGGAATAATATATGGATGTTCAAGATTCACCAAAGAACCATTATTGCCAAATAAAGAACACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22298
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021053 Essential Splice Site 348 1542 11 57
ENSDART00000134102 Essential Splice Site 174 1368 5 51
ENSDART00000137074 Essential Splice Site 50 170 2 6
Genomic Location (Zv9):
Chromosome 13 (position 24980627)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24626287
GRCz11 13 24756737
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAGTCCAGACAGCACTCTTGCAGTCAGCACAGGCATCTCCACTGCAGG[T/C]GTTTGTTTTATTCAACTTAGCATGGACTGGGTTGTACCATGTTCTGCTGA
Long Flanking Sequence:
AAATGAACCTTCCCCATTTTAAAAGTGTTTTTTGGGAATAATATATGGATGTTCAAGATTCACCAAAGAACCATTATTGCCAAATAAAGAACACTTTCATATAGAAAAGCCAGGATACACTTGTACTTAATGATAAATTCAAAGCCTATGCTGTGTGCATTAATTAACATTCAGTATACATAAAAACTTAGACATACTTTGACAGACACACATTGGATATTTACAGATTTTTTTCTTCTTCCTTTACAGTCTATGGCTTCCACAATAATTTAGCTCCTTCCACTGGAGTCCTAACGTCCAGCGGAGTTAACACACAATCAGGTATCCTCTGATGCATATGCTATTAAATAATTAATTATGACAGTACCTTGACAAATGGTAATGGTCATTCATTGTAAGTTTATTTTTTGTGTGTATTTTTTAGGATATGGAGTGCAGAAGAATTATTCCTCAAGTCCAGACAGCACTCTTGCAGTCAGCACAGGCATCTCCACTGCAGG[T/C]GTTTGTTTTATTCAACTTAGCATGGACTGGGTTGTACCATGTTCTGCTGAATTGTCACAGTGTTTTGTGTTTATTAATTCTATGTAATATCCCTTGGAAAAAGAACAATTTTATAGCTGGATAAAATGTTTGGGGTTGGTTATTTGTTTTAAAAAGATCTTTTAAAAAAGTTTTTTTTTTCTAAAGAAGGCACAACATCTGCACATATATCATTAAGAATAAATGAAAAACATTTTAATTATATTCTAATATAATGATAAAGAAAAATTCTAGTATGATTATTTAATGCTCAAGAAGCCTTTTCTTTTAATATCAATGTTTAAATGTATGTAGAAACTGCTATAAATCTTTTTTCAGGATCCTTTAATAAATAGTAAGTTTAAAATAACAGTTTTTTATTCAAAATATAAAGGTTTTGCAACAAAAATAATTTACTGTCATTTTAGATTAATTTAATACATCCTAATTTTGTTTTGTTGCTTGGTTTGTGAAAAAGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18664
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021053 Essential Splice Site 1063 1542 44 57
ENSDART00000134102 Essential Splice Site 889 1368 38 51
ENSDART00000137074 None None 170 None 6
Genomic Location (Zv9):
Chromosome 13 (position 24995472)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24641132
GRCz11 13 24771582
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCTGGTCCCCCAGGMCCTCCTGGACCACCCGGTCGAGAAGGCCGTAAAG[G/A]TAAAAATMTTGAAWAATGACRAGAACACATTCTGTGCASGTATATTMTCA
Long Flanking Sequence:
TAACCTGTTTAAATGATTATATTATGCTTTAAAAACTTTGTTTAAATTAGAAAATATAATTACTTCATATGATATCTAATACAAATATCTAAACTTCTATTGAAAAACATCTGCACTGATGTTCAAAGTGTACACTTAAATGGGATTTATTCATGTCATGTTTGATTCGGAATATATCACATATCCAAAAACTAAAGAATTATTACACTGGGACGAAACTTCAAAGACACACTTAGGGCACACATAAGACTTATTTCACCTTTTAAAAAGGAAATAATAGGAACCCTTTGTCAAGTACTAAACGATTATATTGTGTTTACTCTTAATTGAAAGATTGTTAAGAGATTATAAATCATCTTATACATAGCTTTTTAAATGCAAATATAATTCATATGCAACTTATTATTTTTTCCCCTTCAAAGTTTCTGAGTATGGTGTGGCTCAAGGGCCACCTGGTCCCCCAGGACCTCCTGGACCACCCGGTCGAGAAGGCCGTAAAG[G/A]TAAAAATCTTGAATAATGACGAGAACACATTCTGTGCAGGTATATTCTCATCTACAGTCTGGTATTTTTATTAATTCCTTAGGAGATCCGGGAGTACCAGGTACTTCTACCTTCCAAGGAGAGTCAAGAGGTAAGACTTCATTGATCTAAGAAAACAAACAAATGTTCACTCTTGTCACTTCTCTAGACAAGAACTGTAACAAGTTTTTTTTGTCCACTGTAACCAACGATTTACTGTTATAAACATAATACATGTAATAATGTTATTAATGTGACAAAATATAGAGATCAAATTCAGATTTACAAAGAACGTTATACCTCGAGTTAAAGTTATACTTTGAGATCTATTGGAGATTCTAGACCAGGTCTACCAGCACCACCTTAAAAGTTAGATCATGTGTGGGATGTTCTCAGTTTGGAAATAGTGGACCCACAGAAACTTATTAAGAATATAATTGATCTCTAATTGTATCATACCTAGATTAGTAGTGGAGATACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22299
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021053 Nonsense 1379 1542 53 57
ENSDART00000134102 Nonsense 1205 1368 47 51
ENSDART00000137074 None None 170 None 6
Genomic Location (Zv9):
Chromosome 13 (position 24998046)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24643706
GRCz11 13 24774156
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGGCGCTATGTCCAAGGGCCACCTGGGCTGCCTGGACCCCCTGGTCAG[A/T]AGGGTGACCGTGGTGAACCTGGGTACAGTTATCAAAATGGCAGAAACCAA
Long Flanking Sequence:
GAGTAATTATTGTACTGTCGGATACTCTGTAAATGTATATTGTACTGTTTTATATCCATAAAAAAAAAAAAAATTGTAATGTGATTTTATGGTATGCAGAATCTGGTTTTAGGGGACCTCCAGGCCTACCTGGTCCAGCAGGACCCCAGGGTCCTCCAGGAGACACAAGGAGCCTTGTATCATATACAGGATCTTCTGCTCGAGAACAGATCCGTACTGAACTGCAGGACTACCTAAACAGTGAGTGTCACTCAGCACATGCTCTAATCTGGAAACTGACACCTCAGTGTAACTTTACATTAGACACTTGCACTTGGTGAGCTCTTGGCTGATTTAACCAGTGATCAAATTCTCCTACATTCTAAGATTGTAAACTTCACATATCACAGGTTTGTCTCACTAGTTGCTGCAAACATTTTAAAAAGTATCTTGCCTACCCAGGTGACACTATGAGGCGCTATGTCCAAGGGCCACCTGGGCTGCCTGGACCCCCTGGTCAG[A/T]AGGGTGACCGTGGTGAACCTGGGTACAGTTATCAAAATGGCAGAAACCAATATCGCTATGGCACTGAAATCAGTGAACCAGTGGACTACTCCAATGTTGCACTAAAAGTGACTGATTACATTAAGGGTGAGTACATTGTCATTCAATTCCTGTGCACCAGTTAAATATATACTGTATTAAAACAGCTTTAGCACAGGGTAGTTTAAAAAATCAAGTACAAAAACTAGCCAGGCTTGTCTCCTAAGAACCAAAATTTTCCCTTTCCCCATTTTTCTAGTTGCATTTTCAGTCTGAAGTGATATTTACAAACACTGAAGCGAAATTTTTATTGTGATTTATGGGTTACTTGCTAATGGAGGTGGACTGTAGATGTAAAAAAAGTAGCTTTATGTAATGTAACTGTGATCTGGAAACATTACATTTGTCATTGTTTGTTAGACCAACCAACAACAGGTGATTCAATTAACTACCATGTATTTATTTAACTGCCCTTACCTTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4504
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021053 Nonsense 1496 1542 55 57
ENSDART00000134102 Nonsense 1322 1368 49 51
ENSDART00000137074 None None 170 None 6
Genomic Location (Zv9):
Chromosome 13 (position 25000932)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24646592
GRCz11 13 24777042
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCCAGGGCCCCCTGGCAGGTCAGGGCCCAAAGGAGAAAGAGGATATCCA[G/T]GACCTAAAGGAARTAAAGGTAMCRTACTAACTGTCATTCACATAAGTTTA
Long Flanking Sequence:
CATCTAATAATGAGTAAGCTACATAGGAATCCAGCCAACATTTCTATGAAACTACCATAATAATAGGCAAATCCATCAAACTGCCGGTCCTCTACGGTGTCTATTCTTCAGAGACTATTCAGGAAAACACACTGGATGGATAGCTGGTCCATCACAGAGTTAATTAGCAAATCTCAATCTTTTTCCTCAGATCAAGGTCTGCTGCAGGACCTGACAGAGGGATACTGGAGGTCACAAGCAGGAAGCATTCAAGGACCCGCTGGGCCTCCTGGTCCTCCTGGCCCACCCGGGTACAGCCGTGTGATTGGTGCCTATGGGAACGTGACAGCTGATCTCATGGACTTCTTTAGAAGTTACTATTCACTTTGTCACTAATGCCGATTCTACATTTAATCACTGTTGCATTATTTGTTCCTAAACATTATTTTTTTATTTCAGCATATGGGACAATCCCAGGGCCCCCTGGCAGGTCAGGGCCCAAAGGAGAAAGAGGATATCCA[G/T]GACCTAAAGGAAATAAAGGTAACATACTAACTGTCATTCACATAAGTTTACTGACCAATTAAACATGAAAGTCAAGTGCTATCATTTTTATATTGCTGTATGATCTATAGGGGACACAGGGAGCTCGGGGATACCTGGCCTACCAGGACAAAGAGGACCTGAGGGACCAAGGGGAGAAAAGGGTGAAAAAGGTTAATCAGTTTGCAGTTTTGTTTGTTCTAGAATGAATAGGGTTGGATGATGTAGACCAATTTGGCATCAGACGAAACATGGACGATGGCATCGGCATTGTGGCGGTGAATTAATAATTTTTGAATAAATTAATAATTCATTTATTCACAACTTATTAATTATTTGTAGCTTACCGTTTCAACTACCTGACACGCACGGTCTTTGTTATACCCATAATCAAATCATAAATGAAGTTCCACACAAATTACCACCTGTCAATCCCTTTTTCCGCGGGACTCTGGCATGAATAGGCAGAGTGATCGGTGTCG
Associated Phenotype:
Not determined