Busch Lab

ZMP

ENSDARG00000078992

Ensembl ID:
ENSDARG00000078992
Human Orthologue:
WNK1
Human Description:
WNK lysine deficient protein kinase 1 [Source:HGNC Symbol;Acc:14540]
Mouse Orthologue:
Wnk1
Mouse Description:
WNK lysine deficient protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2442092]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa16044 Nonsense Available for shipment Available now
sa16394 Nonsense Available for shipment Available now
sa44298 Nonsense Mutation detected in F1 DNA Not yet available
sa38068 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16044
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086631 Nonsense 293 1606 3 23
ENSDART00000086631 Nonsense 293 1606 3 23
Genomic Location (Zv9):
Chromosome 25 (position 21813200)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21045076
GRCz11 25 21142730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCTTTAGCCCACCTGCAATGATTGACATTTTTTGTGCCCTTGTAGGTA[T/A]CTAAAACGGTTTAAGGAGATGAAGATCAAAGTCTTGCGCAGCTGGTGCCG
Long Flanking Sequence:
AGGGGTGTGTTCATAAACGTATACAGAACACTGTATTTAAACCACATAAACCTGCATGTAGTATAAAAAAACTACCAGCACTTTAAATCACATTTAATTAGTCAAAATAATCACACAGCAAAGATTAAATTAATGCCATACCTCCTGACAAAACATTACTAATTTTGCCAATGTGACCATACCTTTGTACATACCCAATTTATATTTTATTCTAAAGTATGACATTTTTTTTAGGATCGCAAGTTGTCCAAGTCAGAGCGGCAGCGTTTTAAAGAGGAAGCTGGAATGTTGAAGGGTCTTCAGCATCCCAACATAGTACGCTTTTATGACTCCTGGGAATCATCCTTGAAAGGGAGGAAGTGTATTGTCTTGGTGACTGAACTCATGACATCTGGGACACTCAAGACGTAAGTGCTCTTATTTGTTCCTGTCAGTATTGTTTTTAACTACGCTCTTTAGCCCACCTGCAATGATTGACATTTTTTGTGCCCTTGTAGGTA[T/A]CTAAAACGGTTTAAGGAGATGAAGATCAAAGTCTTGCGCAGCTGGTGCCGGCAGATTTTGAAGGGCCTACACTTCCTTCATACCAGGTCACCACCTATCATCCACCGGGATCTGAAGTGTGACAACATCTTCATCACTGGGCCTACTGGATCAGTCAAGATTGGAGATTTGGGCCTTGCGACCCTCAAGAGGGCCTCCTTTGCTAAGAGCGTCATAGGTACGGCTAAGTATTAACAACTCCAAGTTGAAATCTGTTTGAACTGCCTGATTCTGATTTGTGGTTGGGGGGAAAGAAAGTCCTTCATTTCATGTTTCTTTTTCAAGTTTCTTTTCTTCTTCTGCTTCTTTTCAAAGCGCGTTTTAAAAACAGTGGTGAGAAAGCAGACCACAGCGTTTCCCTGACCGCTCAAACCTCAGTAAACCAGGGCTCCTGCTATATGGAAGTTGTCTCTTGACACCCTCCTTTTAGTTCAAACATAGTTTTTTTCTCCTTTCTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16394
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086631 Nonsense 293 1606 3 23
ENSDART00000086631 Nonsense 293 1606 3 23
Genomic Location (Zv9):
Chromosome 25 (position 21813200)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21045076
GRCz11 25 21142730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCTTTAGCCCACCTGCAATGATTGACATTTTTTGTGCCCTTGTAGGTA[T/A]CTAAAACGGTTTAAGGAGATGAAGATCAAAGTCTTGCGCAGCTGGTGCCG
Long Flanking Sequence:
AGGGGTGTGTTCATAAACGTATACAGAACACTGTATTTAAACCACATAAACCTGCATGTAGTATAAAAAAACTACCAGCACTTTAAATCACATTTAATTAGTCAAAATAATCACACAGCAAAGATTAAATTAATGCCATACCTCCTGACAAAACATTACTAATTTTGCCAATGTGACCATACCTTTGTACATACCCAATTTATATTTTATTCTAAAGTATGACATTTTTTTTAGGATCGCAAGTTGTCCAAGTCAGAGCGGCAGCGTTTTAAAGAGGAAGCTGGAATGTTGAAGGGTCTTCAGCATCCCAACATAGTACGCTTTTATGACTCCTGGGAATCATCCTTGAAAGGGAGGAAGTGTATTGTCTTGGTGACTGAACTCATGACATCTGGGACACTCAAGACGTAAGTGCTCTTATTTGTTCCTGTCAGTATTGTTTTTAACTACGCTCTTTAGCCCACCTGCAATGATTGACATTTTTTGTGCCCTTGTAGGTA[T/A]CTAAAACGGTTTAAGGAGATGAAGATCAAAGTCTTGCGCAGCTGGTGCCGGCAGATTTTGAAGGGCCTACACTTCCTTCATACCAGGTCACCACCTATCATCCACCGGGATCTGAAGTGTGACAACATCTTCATCACTGGGCCTACTGGATCAGTCAAGATTGGAGATTTGGGCCTTGCGACCCTCAAGAGGGCCTCCTTTGCTAAGAGCGTCATAGGTACGGCTAAGTATTAACAACTCCAAGTTGAAATCTGTTTGAACTGCCTGATTCTGATTTGTGGTTGGGGGGAAAGAAAGTCCTTCATTTCATGTTTCTTTTTCAAGTTTCTTTTCTTCTTCTGCTTCTTTTCAAAGCGCGTTTTAAAAACAGTGGTGAGAAAGCAGACCACAGCGTTTCCCTGACCGCTCAAACCTCAGTAAACCAGGGCTCCTGCTATATGGAAGTTGTCTCTTGACACCCTCCTTTTAGTTCAAACATAGTTTTTTTCTCCTTTCTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44298
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086631 Nonsense 413 1606 4 23
Genomic Location (Zv9):
Chromosome 25 (position 21811413)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21043289
GRCz11 25 21140943
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTACTTCTGAGTACCCGTACTCCGAGTGTCAGAATGCAGCTCAGATCTA[T/A]CGCAGAGTCACCAGCGTAAGTCCACATTTCACTGGCGGAGGAGAGAGTCC
Long Flanking Sequence:
ATATATTCATTCTACTTTTTAGAGTCATGTGGTCAGTTCAGGCTATGGAGTGAGTCCTGTGCACCAGTTTGGTTTTTCACATACACATTCTTGCCCTTGAAGGTCTTACACAGAGAAACTTGGGCTTTTTATCATTGCAGTCTAACTGAGGGCAGTTTCCCCTTCCTCTTTTTTTTTTTTTTGTTTTTTTTTTGTTTTACTCTCTATCCCCCTTTTGCTCTCCTTCCCTCTACCTCTCTCTATTCTCGCAGGTTGCTCCGAAGCAGTCTTCAGCGACAACATCATCTTCCTCTCACCTCTTCACAGAGAGGGTGTAATTGGGTACTGAGAGAGTTCTGAACCATTCTTTTAATTTAAGGTACCCCTGAGTTCATGGCGCCTGAGATGTATGAAGAGAAGTATGACGAGTCGGTGGATGTGTATGCCTTTGGGATGTGTATGCTGGAGATGGCTACTTCTGAGTACCCGTACTCCGAGTGTCAGAATGCAGCTCAGATCTA[T/A]CGCAGAGTCACCAGCGTAAGTCCACATTTCACTGGCGGAGGAGAGAGTCCTCGTGCACTCATCCTCCCCCTTGTTTGCTGCACTGTTTTAGTTTTTTATCACTTTTTGCCCTCTGTGGGGTGTTTCCTTTCTGCTTTTTTCTCACAAAGTGGTAAGTCGGGTTTTTTACCTTTACCAGTAAATCTTGAAGTCATGGTCTCTTACAAAACCAATAATGTTCGGAATAAAACAACCTAATTGAATCAGACCGTAAAAGCCTGTTCACAACCCCGAAAACTATATAGCCACACCAATCCATTATAACAGTCTTGTTTATTATAAGTGCATGCTAGGGCTAGGCGATTTAATAGAAAAATAAATTGAAATTAACATTAAGAATCTATAATCGATTCAGCTTTTTCAGGTCCATTTTTTTTAATTACAGCGTATGGAGTCATGTGACCCAACGGTGTTAAGGCTGATACTTGTGCATCGAACGCATGGATATGGTCCAGCGCAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30250
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086631 Essential Splice Site 609 1606 7 23
Genomic Location (Zv9):
Chromosome 25 (position 21803523)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21035399
GRCz11 25 21133053
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGAAGCAGAAACAGACCAGCACCAGCAGCCTGGAGCCTCTGCTTCTG[G/T]TTAGTGTCACACAAGTGACACCTTTTTTTTGCTCTGGGCCTTTTGGTAAT
Long Flanking Sequence:
CTTGAAAATATGATTGGCAGAATCGTACAAATGCTGGATTAAGATCGTCTAGGGGGTCGAATCGAGATCACGATCTTTTTTTGATTAATTGTGCACCTCTACATCTAAAGATTCAAAATCGTTTTAAATTGACCTCATTGGTTTTTTGTTTTATCACGTTGACATTTTATGTTGTTATTACTAGGTAGTTGACGTTTAATTACACTTATTTTCACGTAACCGTTTTTTATTCTAGGTTGAATCAGGCTACATTTGTGAGGGTGACCACAAAACCATTGCAAAGGCCATAAAGGACAGAGTGTCCCTGATCTCCCGTAAGAGAGAGCAGAGAAAACTGGTGAGAGAAGAACAGGAAAAAAGGAAGATGGAGCAGGAGAATGACGCCGCCCAGCAAACTAACCCCACAGTCAAGTCCCCTGGTTCTGCTCTGGCCTCAGTCATAATGGAGTCTGAAGAAGCAGAAACAGACCAGCACCAGCAGCCTGGAGCCTCTGCTTCTG[G/T]TTAGTGTCACACAAGTGACACCTTTTTTTTGCTCTGGGCCTTTTGGTAATGACTGTGTTTGCAGTTAATAATAATATTAAATGCAAGTGTCTGTTAATGTTTTAGACTCTTTTGGAGAAAAACAAAATCTTAATATGGGATATTTTATTTAGTGGACAAGATATATTAATATTATTTAAATACATAAAGTAATTTAATCATCATAGATAAAGTGATCATGCTAAATTGTAACATTTTTAAATGACTGGCTGAAAATAGGTTAAATTCAGTAGTTTGAAGGACAGTTAGATCCTTGAATAGTCTCTAAAATCCCATTAAATATTTTTTGATTAAATCTGCTTGACAAAAGTTTTTGGTATGCAAATTATTATAACACGGAATGGTACTTTTCTGGGCGTCATCAGTAAATGATTTTCTCTTTAAATTTTTTCGCTACTGATTAAATTACTAATTAAACAGTAAATATCATATTTTATGAAATATGCTGTTAAATTCTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38068
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086631 Nonsense 808 1606 13 23
Genomic Location (Zv9):
Chromosome 25 (position 21797241)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21029117
GRCz11 25 21126771
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTGTTCTGTTTTTATAGATTTCTAATATTGGAGACAGAGTCGCTGAATG[T/A]CAGCTGGAAACCCACAACAGAAAGATGGTCACATTCAAGTTTGATCTGGA
Long Flanking Sequence:
TTAAAACTGAATTTGAACATGTAATTTCTTTACAGGCACCACTAAGTGTGTCCCAATCACAACCAGTAGAGCAGACACAACCTCAAACATCTCTGGTTCCTGCCTCCACAGAAAGGTGAAACCTGTTTTAAAAATCCACATGAATGAATATTGAGGTTCCAGTTGAGAGAACTTGAGTTAATTTAGTTTTTTTTCCCTTCAGTGGACACTCTGATCCGGCATCTGGTCTAAGCGATGGGAATGAGGGGAGACACGAGGGTCGCTCTATGAAACGACCCCAACGCCGTTCTGTACGCAGCCGCTCGCGTCATGAAAAAACAGCTAAGGTCAAGCTCAATGTGCTAAATGTAAGTTACTCACAAATCTGATTGGTCTATAATGTTGGCATTACATTATAATGATTAACTGATTATAAGCACAGCATATAAGTACATATTAAAATGTAGTCCGGTTGTTCTGTTTTTATAGATTTCTAATATTGGAGACAGAGTCGCTGAATG[T/A]CAGCTGGAAACCCACAACAGAAAGATGGTCACATTCAAGTTTGATCTGGATGGGGATAATCCTGTAGAAATCGCTGAAATTATGGTAAAACTTTTGCATACTTTTATTTTTTTCAGCATAGTGGATTAGGCTGGGAACCTTATCAATCAAACAGTTGTTGATGATCATAACCATTAATTACCCCATTTGTTATATTATTATTTTATAATTAATTTTGTTTTAATTTTCGTTTGTTTAGCAATTTATTTGGTAATATATTGGTTTCCATTGTCCAGGATGCTCAACGTTAAATAATCATTTAGGTGGCATTTACTCTCCAAGACTTTGACACATTAGATGTTTTGTCCCACATGTTTTCCAATTTTTTTGAGGGTAAAAAATGTTTTATCAATTTTGCATCTTACACATTTTAAATATAAAATGATCAATGATATTTCTCAATTTCCTTCCACTGAAGAAATATTAGGCAGAGCTTAAATTAAAAACTATAATCATAACTG
Associated Phenotype:
Not determined