Busch Lab

ZMP

si:dkey-77f17.3

Ensembl ID:
ENSDARG00000078989
ZFIN ID:
ZDB-GENE-050419-48
Human Orthologue:
ALPK3
Human Description:
alpha-kinase 3 [Source:HGNC Symbol;Acc:17574]
Mouse Orthologue:
Alpk3
Mouse Description:
alpha-kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2151224]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa36662 Nonsense Mutation detected in F1 DNA Not yet available
sa36663 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1277 Nonsense Available for shipment Available now
sa23314 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36662
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110843 Nonsense 112 1872 3 13
ENSDART00000141672 Nonsense 120 636 5 6
ENSDART00000145212 None None 428 None 8
Genomic Location (Zv9):
Chromosome 18 (position 26668496)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26741751
GRCz11 18 26724129
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTACAAAGATGACATGGAGTTAGATCGATATTGTGGTCTTCCCAAATAT[G/T]AAATATTTCGCAATGGAAAAACTCACACACTCCACATCTACAAGTAAGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2993
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110843 Essential Splice Site 126 1872 3 13
ENSDART00000141672 Essential Splice Site 134 636 5 6
ENSDART00000145212 None None 428 None 8
Genomic Location (Zv9):
Chromosome 18 (position 26668540)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26741795
GRCz11 18 26724173
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATATGAAATATTTCGCAATGGAAAAACTCACACACTCCACATCTACAA[G/T]TAAGTTGCCTAGTTCAATATATATTGTTTATCATTGAAATACTACAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36663
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110843 Essential Splice Site 629 1872 5 13
ENSDART00000141672 None None 636 None 6
ENSDART00000145212 None None 428 None 8
Genomic Location (Zv9):
Chromosome 18 (position 26680089)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26753344
GRCz11 18 26735722
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGATAAAGCCAATGTTACCTATTTAACAAGCAACTCTTTATGTCTCAA[G/A]GCTAAAGAAGACCAGGCTAAACCCAGCAGAACTGATGTTCCTGACTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1277
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110843 Nonsense 1516 1872 7 13
ENSDART00000141672 None None 636 None 6
ENSDART00000145212 Nonsense 72 428 2 8
Genomic Location (Zv9):
Chromosome 18 (position 26689520)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26762775
GRCz11 18 26745153
KASP Assay ID:
554-1192.1 (used for ordering genotyping assays)
KASP Sequence:
CCAGTAGCACTGGCCATAGTCCAGGCTTCCAGCAGAGACTGTGGAGTGTA[T/A]GGCTGCTCAATCAAAAATGAATATGGGACTGACATCACTGATTACTTACT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa23314
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110843 Essential Splice Site 1549 1872 9 13
ENSDART00000141672 None None 636 None 6
ENSDART00000145212 Essential Splice Site 105 428 4 8
Genomic Location (Zv9):
Chromosome 18 (position 26690817)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26764072
GRCz11 18 26746450
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACATAGTGTTGTTAACCTACACTGAGTTTCTATATTTCTGTCTTCTCA[G/A]TTGGAGAAGAGATTGAGATGACACCAATGATGTTCACCAAAGGCCTGGCA
Associated Phenotype:
Not determined