Busch Lab

ZMP

sbno1

Ensembl ID:
ENSDARG00000078969
ZFIN ID:
ZDB-GENE-080522-2
Description:
Strawberry notch homologue 1 [Source:UniProtKB/TrEMBL;Acc:D6RUV3]
Human Orthologue:
SBNO1
Human Description:
strawberry notch homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:22973]
Mouse Orthologue:
Sbno1
Mouse Description:
sno, strawberry notch homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2384298]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4397
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113907 Essential Splice Site 488 721 11 16
Genomic Location (Zv9):
Chromosome 10 (position 46457334)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44428281
GRCz11 10 44344973
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGCARAACAAGCTGCCRAAGGCACGAGTCGTGTACGCTAGCGCCACAG[G/A]TTTGTGWTTACACTTCAGTATCCTGGAGCAGATCTCAGCATGTGTGCATT
Associated Phenotype:
Not determined