Busch Lab

ZMP

si:dkey-3p8.7

Ensembl ID:
ENSDARG00000078924
ZFIN ID:
ZDB-GENE-041008-216
Human Orthologue:
TMCO4
Human Description:
transmembrane and coiled-coil domains 4 [Source:HGNC Symbol;Acc:27393]
Mouse Orthologue:
Tmco4
Mouse Description:
transmembrane and coiled-coil domains 4 Gene [Source:MGI Symbol;Acc:MGI:1924306]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa37774 Nonsense Mutation detected in F1 DNA Not yet available
sa15728 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29992
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113893 Nonsense 208 688 7 14
ENSDART00000134589 Nonsense 193 668 6 13

The following transcripts of ENSDARG00000078924 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 39850133)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39811698
GRCz11 23 39704609
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAATTTCTTCATATCTTTAATTTCTTTTGTGTGTTTCTCAGGGGTTACA[G/T]GAGGACTGGCGGCTCCTCTGGTGGCTGCTGGAGCAGGAGCAGTGCTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37774
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113893 Nonsense 360 688 10 14
ENSDART00000134589 Nonsense 340 668 9 13

The following transcripts of ENSDARG00000078924 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 39860317)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39821882
GRCz11 23 39714793
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTCCATCCTCAGGGATAGTGACCGCTCTGACATGGCCTGCATCTCTGT[T/A]AGCTGTGGCCAGTGTGATCGACAACCCTTGGGGAGTTTGCTTGAGCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15728
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113893 Nonsense 587 688 14 14
ENSDART00000134589 Nonsense 567 668 13 13

The following transcripts of ENSDARG00000078924 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 39872563)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39834128
GRCz11 23 39727039
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGWAAATGCTGATGAAAACCAAAAGCAGAGCGAAGTGCGGTGCGAGAGG[C/T]AGGACTCTGAGAATGGCWGGGATATTCCTGATATATCCGATTTACTCGAC
Associated Phenotype:
Not determined