Busch Lab

ZMP

comtd1

Ensembl ID:
ENSDARG00000078918
ZFIN ID:
ZDB-GENE-030131-1072
Description:
catechol-O-methyltransferase domain containing 1 [Source:RefSeq peptide;Acc:NP_001157280]
Human Orthologue:
COMTD1
Human Description:
catechol-O-methyltransferase domain containing 1 [Source:HGNC Symbol;Acc:26309]
Mouse Orthologue:
Comtd1
Mouse Description:
catechol-O-methyltransferase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1916406]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8488 Nonsense Mutation detected in F1 DNA Not yet available
sa1067 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28087
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108921 None None 238 None 7
ENSDART00000137776 None None 119 None 3
ENSDART00000148269 Nonsense 7 286 1 7
Genomic Location (Zv9):
Chromosome 13 (position 17721518)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 17541553
GRCz11 13 17672545
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAGGTAAACTTTGATAAATCAATATCATGCAAACAGCAGTCTCTTTTTA[T/A]CTGAGGAGGCCAAACAAACAAAATCTAGACTTTCCACCTCAGCTGGTGGA
Long Flanking Sequence:
TTTTAAATTAATAAAGAAATTTTAGATTTAGGTTAAGTAAACATCTTAAATGTAGTTGTACAGACATTTTAACAGACTTTTGCCAAACCAACAAAAAAAAAAAGTAATTTTAACTTTTTTCAAGTTGGATTTTTTTTTTACAGATAATTTATTTATTAACGTGGGTAACTGTGAACAGAGTAATTCATGATAATCAATGGTTTCCTGGCAAATTAGAGTCTTACTGTAACATTTTATCAGTCCTAAAAGTACAGTATTTGAAACAGCACCTGCCTGTTGTGAATGTAAAGTGCATGTTACTGTGATGGCTTTTGAAATAAATTCAATCCAACCTGAAAACCTCTTAAAATCTCTCAAAATTATAGCTCTTGGCAATTAAATGTAATTCTCTCCAAATTTCTGTCTACACTATTCTGTGTATACCACAACAGCTACGAACAAAAGTACTTGTAAGGTAAACTTTGATAAATCAATATCATGCAAACAGCAGTCTCTTTTTA[T/A]CTGAGGAGGCCAAACAAACAAAATCTAGACTTTCCACCTCAGCTGGTGGAAAAAAAAAGCTTCACTTCACAATTTCAGTCATCTCTTGGTTTCTGCAGATTAAGCCTGGCTTCTGACATTAAGATGCTTTGTACCTTCAGCCTTATCTTGGCGTTAACAGGTAGGCTCATGTCAACTTTCATTATGACGGTCTATGTTTACATTTTAAGCCCTGGGTAACAGTCATTTGACTTCTAAAATACAAACACAGTACTTGATAAATGCAGTTATTTGTTTGTTGTTTTTAGTGTGTCTTAAAGGAATAAATGAGCCCAATTTGATTTTTATTTTAAAATATATTTAATTTAATTTAATTTAAATTTACATTTTAATTTAGCTAAATTGTGTATAAACACATCACTTCAAAAAGTAGATATGAATACAATTGTGAAGTTGGGTGTATGTAAATGCAACTGAAGTCGAGATTTTTTGGCTGCAAAAAACGTAATTTTGAGAAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8488
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108921 Nonsense 94 238 4 7
ENSDART00000137776 None None 119 None 3
ENSDART00000148269 Nonsense 142 286 4 7
Genomic Location (Zv9):
Chromosome 13 (position 17729464)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 17549499
GRCz11 13 17680491
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAACGCTCATTTTGTACCTCTCTTAGGTCTGTACACTGGATACAACGCCT[T/A]RAGTCTGGCTCTGGTAGTTCCTGAGAATGGACGTGTGGTGGCCTGTGAAA
Long Flanking Sequence:
CATGTTCAAAGTCACTTAAATCACCTTTCCTCCTCGCTCTGATGCTTTGCCATTCTGACCATCTTGTCTTCACCATGTCTGCATGCCTAAATACATTGAGTTGCTGCCATGTGTTTGGCTGATTAGAAATTTGTATTAACAAGCAGTTGGTACCTATTAAAGTGGCTGGTGAGTGAATGTAATTGAATATTTCATGAGAACTATGGAGGACACTAGATGTCAGTAGAGGTGACAATTCTGTACAATAACCCTTTTCACATGGATATTTTTTTGTATATTTAAAGAGAACTATGGAGGATGCCAGAAACGTCATGATGGTGGCATCTGAGCAGGCTCAGCTAATGGCTAATCTGGCTAAACTCATAGAAGCCAATAAAACTATTGAGATTGGTGAGTGGAAGGAGCAAAATTACAAAAAATTATGTGCTTACATTCTTTTGGCTACCTGTAAAACGCTCATTTTGTACCTCTCTTAGGTCTGTACACTGGATACAACGCCT[T/A]GAGTCTGGCTCTGGTAGTTCCTGAGAATGGACGTGTGGTGGCCTGTGAAATTAATGAGGATTATGTGAAAATAGGCAAGCCATTTTTTGCAGAGGTAAAGCAAAACGTACAAAGTTTGTAAAGCTGCATTTGGTTGCAACTGAGGTGATTTGTTTGATTCGGACACATCATTGCTTTCATCAACTGTATCTGTTAAGTTGCTCCTCAACAAACACCTACACAATTCTCAATTTCAATATTGATTGCTGCCTGTCATTGTAAGGACAGCGTCATCAGTATATAAAGCCAGCTGGGCAGATGCAGAAATGTCCATCAAGCTGATTGCTGACATGGACAGATTGGGGGATTCTACATTTGGGTGCTGATATTTGCACAAAATTAAATTGCAAAGTGCTTCATCTACATTTTGTCCATCCTATAAGTAAAAATAGGAATGTGTGCATAAATGAATAACCTAATGAAGATTATCACCTATCATAGAAGTAATATTATATGTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1067
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108921 Nonsense 120 238 4 7
ENSDART00000137776 None None 119 None 3
ENSDART00000148269 Nonsense 168 286 4 7
Genomic Location (Zv9):
Chromosome 13 (position 17729541)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 17549576
GRCz11 13 17680568
KASP Assay ID:
554-0970.1 (used for ordering genotyping assays)
KASP Sequence:
ATGGACGTGTGGTGGCCTGTGAAATTAATGAGGATTATGTGAAAATAGGC[A/T]AGCCATTTTTTGCMGAGGTAAAGCAAAACGTACAAAGWTTRTAAAGCTGC
Long Flanking Sequence:
TCTGCATGCCTAAATACATTGAGTTGCTGCCATGTGTTTGGCTGATTAGAAATTTGTATTAACAAGCAGTTGGTACCTATTAAAGTGGCTGGTGAGTGAATGTAATTGAATATTTCATGAGAACTATGGAGGACACTAGATGTCAGTAGAGGTGACAATTCTGTACAATAACCCTTTTCACATGGATATTTTTTTGTATATTTAAAGAGAACTATGGAGGATGCCAGAAACGTCATGATGGTGGCATCTGAGCAGGCTCAGCTAATGGCTAATCTGGCTAAACTCATAGAAGCCAATAAAACTATTGAGATTGGTGAGTGGAAGGAGCAAAATTACAAAAAATTATGTGCTTACATTCTTTTGGCTACCTGTAAAACGCTCATTTTGTACCTCTCTTAGGTCTGTACACTGGATACAACGCCTTGAGTCTGGCTCTGGTAGTTCCTGAGAATGGACGTGTGGTGGCCTGTGAAATTAATGAGGATTATGTGAAAATAGGC[A/T]AGCCATTTTTTGCAGAGGTAAAGCAAAACGTACAAAGTTTGTAAAGCTGCATTTGGTTGCAACTGAGGTGATTTGTTTGATTCGGACACATCATTGCTTTCATCAACTGTATCTGTTAAGTTGCTCCTCAACAAACACCTACACAATTCTCAATTTCAATATTGATTGCTGCCTGTCATTGTAAGGACAGCGTCATCAGTATATAAAGCCAGCTGGGCAGATGCAGAAATGTCCATCAAGCTGATTGCTGACATGGACAGATTGGGGGATTCTACATTTGGGTGCTGATATTTGCACAAAATTAAATTGCAAAGTGCTTCATCTACATTTTGTCCATCCTATAAGTAAAAATAGGAATGTGTGCATAAATGAATAACCTAATGAAGATTATCACCTATCATAGAAGTAATATTATATGTCTATGAAAAGCAAAGAATCAAATGTTTTATTAAGTTAGAACAATTAGAACCTATAAGTGCAAATTGTCTTTGTTTTAGGCT
Associated Phenotype:
Not determined