Busch Lab

ZMP

B8K0E1_DANRE

Ensembl ID:
ENSDARG00000078912
Description:
Novel NACHT domain containing protein [Source:UniProtKB/TrEMBL;Acc:B8K0E1]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa31029 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31029
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105991 Nonsense 649 875 3 7
Genomic Location (Zv9):
Chromosome 19 (position 3098975)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2744953
GRCz11 19 2675837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTGAGATTAAACTCTTCACACCTGACTCAACTGGATCTGATTGGAAAT[A/T]AACTAGGAGACTCAGGAGTGAAGCTGCTCTCTGATGGACTGAAGGATCCT
Associated Phenotype:
Not determined