Busch Lab

ZMP

si:dkey-8f21.3

Ensembl ID:
ENSDARG00000078908
ZFIN ID:
ZDB-GENE-090313-350
Description:
Novel protein similar to H.sapiens FBXO41, F-box protein 41 (FBXO41) [Source:UniProtKB/TrEMBL;Acc:B8
Human Orthologue:
FBXO41
Human Description:
F-box protein 41 [Source:HGNC Symbol;Acc:29409]
Mouse Orthologue:
Fbxo41
Mouse Description:
F-box protein 41 Gene [Source:MGI Symbol;Acc:MGI:1261912]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa19548 Nonsense Available for shipment Available now
sa39662 Nonsense Mutation detected in F1 DNA Not yet available
sa31221 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19548
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113650 Nonsense 169 805 1 12
ENSDART00000140945 None None 323 None 8
ENSDART00000145789 Nonsense 169 387 2 5
Genomic Location (Zv9):
Chromosome 1 (position 42073427)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40989743
GRCz11 1 41690907
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGACGAGAGGCTGGAGAAGCTGTCAGAAGAGGTGGAGCAAAAGATTT[C/A]AGCAAGAGTCAGTCGTCTGCAGGCCGAGTTGGAGAGGAAAAGCTCAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39662
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113650 Nonsense 239 805 1 12
ENSDART00000140945 None None 323 None 8
ENSDART00000145789 Nonsense 239 387 2 5
Genomic Location (Zv9):
Chromosome 1 (position 42073636)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40989952
GRCz11 1 41691116
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGCCTTAAGCAGGATCTGGTTAACAAAGAGCAGGAGCTTTCACACAAA[C/T]AACAGTGAGTTCTTTTTTTCATGATAAACCTCCTACACCTAAATGCTTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5662
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113650 Nonsense 307 805 2 12
ENSDART00000140945 None None 323 None 8
ENSDART00000145789 Nonsense 307 387 3 5
Genomic Location (Zv9):
Chromosome 1 (position 42098340)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 41014656
GRCz11 1 41715820
KASP Assay ID:
554-3608.1 (used for ordering genotyping assays)
KASP Sequence:
CCCCAAATGGCAGCCTGGGACACTGCAGTCTGGGCTCCAAATCTAATGGA[C/T]GACAGGTAAAATTATGGAGAAAGATGAATTACATGAAAGCATTGAAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31221
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113650 Nonsense 617 805 7 12
ENSDART00000140945 Nonsense 135 323 3 8
ENSDART00000145789 None None 387 None 5
Genomic Location (Zv9):
Chromosome 1 (position 42130001)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 41046317
GRCz11 1 41747481
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTGACAGATCGCTCTCTGTGGTTGGCCAGCTGTTACTGCAGGGCACTA[C/T]AAGCTGTCACATACAGGTGAGTCCCTGTGTGCTTTTATCACTCTATGGTC
Associated Phenotype:
Not determined